ID: 1064552946

View in Genome Browser
Species Human (GRCh38)
Location 10:16521035-16521057
Sequence GCTGCTGGTGATCCTCATCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064552946_1064552949 5 Left 1064552946 10:16521035-16521057 CCGGGATGAGGATCACCAGCAGC 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1064552949 10:16521063-16521085 CATCACCACCCCCAGCGCCCCGG 0: 1
1: 0
2: 2
3: 55
4: 578
1064552946_1064552956 16 Left 1064552946 10:16521035-16521057 CCGGGATGAGGATCACCAGCAGC 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1064552956 10:16521074-16521096 CCAGCGCCCCGGCGGCGATCAGG 0: 1
1: 0
2: 0
3: 10
4: 61
1064552946_1064552950 8 Left 1064552946 10:16521035-16521057 CCGGGATGAGGATCACCAGCAGC 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1064552950 10:16521066-16521088 CACCACCCCCAGCGCCCCGGCGG 0: 1
1: 0
2: 4
3: 30
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064552946 Original CRISPR GCTGCTGGTGATCCTCATCC CGG (reversed) Exonic
900704494 1:4071856-4071878 GCTGCTGCTGAGCCACTTCCAGG + Intergenic
900965213 1:5952714-5952736 GCTGCTGGAGCTCCACGTCCAGG - Exonic
901218495 1:7568315-7568337 GATGCTGGTGATCCTGATGAGGG - Intronic
901915770 1:12498740-12498762 GCTGCTGGGGGTTCTCTTCCTGG + Intronic
901920857 1:12536523-12536545 TCTGCTTGTAATCCTCTTCCTGG + Intergenic
902334015 1:15744558-15744580 GCTGCTGGTCATCTACATGCAGG + Exonic
903126937 1:21254749-21254771 GCAGCTGTTGATCTCCATCCTGG + Intronic
907077902 1:51594918-51594940 GCTGCTGGTGACCTGCACCCTGG - Intronic
907837232 1:58121585-58121607 GGTGCAGATGATCCTCATGCTGG - Intronic
909703419 1:78552888-78552910 GGTGCAGGTGCACCTCATCCTGG - Intergenic
909827581 1:80144868-80144890 GCTGCAGGTCATCCTAAACCTGG + Intergenic
911411494 1:97514185-97514207 TCTGCTGGTGATCCTAATAAAGG + Intronic
912962812 1:114211156-114211178 GCTGCTAGTGTTCCCCTTCCAGG + Intergenic
914423357 1:147550628-147550650 GCTTCTATTTATCCTCATCCTGG - Intronic
914950371 1:152108734-152108756 GCAGCTGTTGTTCCTCCTCCAGG + Exonic
914950385 1:152108851-152108873 GCAGCTGCTGTTCCTCCTCCAGG + Exonic
914950864 1:152112325-152112347 GCTGCTGCTGCTCTTCCTCCTGG + Exonic
918082450 1:181218030-181218052 TCTGCTGCTGCTCCTCATACAGG - Intergenic
918334058 1:183489925-183489947 GATGCTGATGATGCTCATCTGGG - Intronic
919085964 1:192920187-192920209 GCTGCTGGTGCTGCTAGTCCGGG + Intergenic
919810063 1:201403429-201403451 GTTGCTGATGCTCCACATCCTGG - Intergenic
920108988 1:203573960-203573982 ACTGATGGTGACCCTCCTCCAGG - Intergenic
920960273 1:210657273-210657295 GCAGCTGCTGCTCTTCATCCAGG - Intronic
921183929 1:212654253-212654275 CCTGCTGGTGATGCACATACTGG + Intergenic
922180230 1:223227637-223227659 GGTGCTGCTGCTCGTCATCCTGG - Exonic
924526902 1:244860909-244860931 GCTGCTGTTGATCCTGCACCAGG + Intronic
1064285414 10:13986923-13986945 CCTGCAGGTGATTCTCATACAGG - Intronic
1064552946 10:16521035-16521057 GCTGCTGGTGATCCTCATCCCGG - Exonic
1065917322 10:30364750-30364772 CCTGCTGATGATCCTGCTCCAGG - Intronic
1067081702 10:43216122-43216144 ACTGCTGGGGACCCTGATCCTGG - Intronic
1068890799 10:62146708-62146730 GCTTCTCATGATCCTCATCTCGG + Intergenic
1071525781 10:86357342-86357364 GCTGCTGCTGTTCCTAGTCCTGG - Intronic
1071572094 10:86702932-86702954 CCTGGTGGTGATCATCGTCCTGG + Intronic
1073731837 10:106297317-106297339 TCTGGTGGTGGTCCTCAACCTGG + Intergenic
1074913051 10:117929282-117929304 GCTGCTGGTGATGCTGATGAAGG - Intergenic
1083374510 11:62208737-62208759 GCTGCTGATGGTCCTCATGCTGG + Exonic
1083381229 11:62270222-62270244 GTTGCTGATGGTCCTCATGCTGG + Exonic
1083681379 11:64353374-64353396 GCTGCCGGTTCTCCTCTTCCTGG - Exonic
1083954651 11:65976739-65976761 GCTGCTGCTTCTCCTCGTCCAGG - Exonic
1084035172 11:66505189-66505211 GCAGCTGTTGATCACCATCCTGG - Intronic
1084575040 11:69983574-69983596 GCTCCGGGTGCTCCTCTTCCAGG + Intergenic
1084701153 11:70787047-70787069 GCTGATGGTGATGCTCATGGTGG - Intronic
1084785903 11:71441548-71441570 GCTGCTGCGGACCCTCATCTGGG + Intronic
1086955598 11:92931855-92931877 GCTGCTGGTGATCCTACAGCTGG + Intergenic
1087272864 11:96129411-96129433 GATGCTGATGCTGCTCATCCAGG + Intronic
1088332445 11:108667686-108667708 GCTTCTTGTGCTTCTCATCCTGG + Intronic
1088606856 11:111540984-111541006 GCTGCTGCTGACCCTCTTCTGGG + Intronic
1089561615 11:119346049-119346071 GCTGCTGGTGGCCATCATCCTGG - Exonic
1092071520 12:5635194-5635216 CCTCGTGGTCATCCTCATCCTGG - Exonic
1094473846 12:30826369-30826391 GCTGCTGGGGAGCCTCTGCCAGG - Intergenic
1096109373 12:49020094-49020116 GCTGCAGTTGAACCTCTTCCTGG - Exonic
1098765431 12:74482596-74482618 GCAGCTGGTGATCCACAGTCAGG - Intergenic
1101210304 12:102528912-102528934 GATCCTGGAGATCCACATCCTGG + Intergenic
1103459308 12:121090999-121091021 GCTGCTGGTGTCCCTGGTCCAGG + Intergenic
1103933652 12:124463809-124463831 GCTGGTGGGGATCCTCCGCCCGG - Intronic
1104775749 12:131389285-131389307 GCTGGAGGTGACCCTGATCCTGG + Intergenic
1105303241 13:19153191-19153213 GCTGCTTTTCATTCTCATCCTGG + Intergenic
1106451796 13:29888935-29888957 GCTGCTGGTGACCCTGGCCCTGG + Intergenic
1109372821 13:61446339-61446361 TCTCCTTGTGATCTTCATCCGGG + Intergenic
1112071825 13:95861306-95861328 GCTGCTGATGGGGCTCATCCAGG + Intronic
1113200789 13:107866374-107866396 GCTGCTGGTGCTCCTTGTCCCGG + Exonic
1113343123 13:109446480-109446502 GGTGCTGGTCACCCTAATCCTGG - Intergenic
1113853948 13:113433784-113433806 GCGGCTGGAGACCCTCATCGAGG - Exonic
1115061836 14:29201328-29201350 GTTGCAGCTGATCTTCATCCAGG + Intergenic
1119402779 14:74375449-74375471 TTTACTGGTGATCTTCATCCCGG + Intergenic
1121398798 14:93653399-93653421 TTTCCTGGTAATCCTCATCCAGG + Intronic
1122703441 14:103605581-103605603 GCTGCTGGTGCTCCTCAATCTGG - Intronic
1129620793 15:77143628-77143650 GCTCATGCTGATCCTCTTCCAGG + Intronic
1131091861 15:89629540-89629562 GCTGCTGGTGCTGCTCCTCTCGG + Exonic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133345966 16:5070637-5070659 GCTGCCTGTGGTCCTCATCAGGG + Intronic
1134310770 16:13073461-13073483 GCTGCTGATGATGCTAGTCCAGG - Intronic
1139430180 16:66906995-66907017 TCTGCTGGCTACCCTCATCCAGG - Intergenic
1139805945 16:69565800-69565822 GCTGCTGCTGTTCCTGAGCCGGG - Intronic
1141722912 16:85766730-85766752 GCTGGTGGTGATCCCCATACTGG + Intergenic
1144497422 17:15757330-15757352 GCTGCAGGGGACCCTCATGCTGG + Intergenic
1144652212 17:17014299-17014321 GCTGCAGGGGACCCTCATGCTGG - Intergenic
1146054072 17:29572585-29572607 CCTGCTGGTGCTGCTCACCCTGG + Exonic
1146415017 17:32623781-32623803 GGTGCTGGTGGCCCTCGTCCAGG + Intronic
1147540130 17:41350500-41350522 GGAGCTGGAGAACCTCATCCGGG - Exonic
1147542147 17:41369483-41369505 GGAGCTGGAGAACCTCATCCGGG - Exonic
1147545361 17:41397272-41397294 GGAGCTGGAGAACCTCATCCGGG - Exonic
1148218232 17:45845464-45845486 CATGCTGGTCATCTTCATCCTGG + Exonic
1148746891 17:49923562-49923584 GCTTATGGAGAGCCTCATCCAGG + Intergenic
1150313718 17:64150718-64150740 TCTGATGGTGACCTTCATCCCGG - Intronic
1152068635 17:78124601-78124623 GCTGCTGGTGGCCTTCATCATGG - Exonic
1153963654 18:10161131-10161153 GCTTGCGGTGACCCTCATCCTGG + Intergenic
1153980164 18:10302112-10302134 GCTGCTGGTTTTACTCATCTCGG + Intergenic
1157366515 18:47069716-47069738 GCTGCTGGTAATCAAGATCCAGG - Intronic
1157982088 18:52393558-52393580 GCTCCTGGTGATACTGATGCAGG - Intronic
1160667198 19:336478-336500 GCTGTTGTTGAGCTTCATCCAGG - Intronic
1161251386 19:3282261-3282283 GCCTCTGGTGAGCCTCCTCCAGG + Exonic
1161723511 19:5916054-5916076 GCTGCTGGAGGTCCTCGCCCGGG + Exonic
1163112588 19:15170464-15170486 GCTGCTGGTCATTCTCGTCCTGG - Exonic
1163351563 19:16779377-16779399 GCTGCTGGTGATTGGCACCCAGG + Exonic
1165755765 19:38291865-38291887 GATGGTGTTGATCCTCTTCCTGG + Exonic
1168266702 19:55227471-55227493 CCTGCTGCTGCTCATCATCCTGG - Exonic
925677851 2:6385167-6385189 GATGCTGATGATCCTGAACCTGG - Intergenic
925932472 2:8720373-8720395 TCTGCAGGTGATCCTGGTCCAGG - Intergenic
926288743 2:11511650-11511672 ACTGCTCCTCATCCTCATCCAGG + Intergenic
931700042 2:64902037-64902059 CCTCCAGGTGATTCTCATCCAGG - Intergenic
932744746 2:74324522-74324544 GCTGCTGATGATGCTGATCCAGG + Intronic
932777805 2:74538985-74539007 GCTGCTGCTGCTCCTCCTCTTGG + Intronic
933783901 2:85822933-85822955 TCTGCTGGTGATCCCCTTCCAGG + Intergenic
935360560 2:102243265-102243287 GCTGCTGGTGATTCTCAGTAGGG + Intergenic
935581534 2:104759824-104759846 GCTGCAGGTGATCTTGATGCAGG - Intergenic
939671386 2:145016829-145016851 GCTACTGGTGATGATCATCTAGG + Intergenic
941180955 2:162258773-162258795 GCTGCTGGAGATTTTCATCCAGG - Intergenic
942139782 2:172966466-172966488 GCTGCTGCTGCTGCTCCTCCAGG + Intronic
943165842 2:184324717-184324739 GATGCTGATAATGCTCATCCTGG - Intergenic
944772062 2:202924736-202924758 GCTGCTGCTGTTGCCCATCCAGG - Intronic
1169698396 20:8418039-8418061 GATGCTGGTGATCTTCACCAGGG - Intronic
1170462964 20:16596511-16596533 GCTGCTGGGTATCCCCAACCAGG - Intergenic
1170570017 20:17627355-17627377 GCTGCTGGTCAGCCTCCGCCTGG + Exonic
1171170952 20:23015038-23015060 GCTCATGGTGTTCCCCATCCTGG - Intergenic
1171206647 20:23286886-23286908 GCTGGTGGTGATACTAACCCTGG - Intergenic
1173979475 20:47212126-47212148 GCAGCTGGTCATCCCCATCTGGG + Intronic
1174734996 20:52957376-52957398 GCTGCTGCTGCTGCTGATCCAGG - Intergenic
1175630914 20:60535485-60535507 TCTGCTGGAAATCCACATCCTGG + Intergenic
1178693105 21:34766484-34766506 GCTGCTGGCAATCCTCATAAAGG - Intergenic
1179799055 21:43802445-43802467 ACTGCAGGTGACCCCCATCCAGG - Intronic
1179976920 21:44873532-44873554 GCTGCTCCTGCTGCTCATCCCGG - Exonic
1182081655 22:27533511-27533533 GCTGCTGGTAATACTCTTCTGGG - Intergenic
1183508390 22:38221676-38221698 GCTGCTGGAGATGCTCTTCATGG + Exonic
1183588369 22:38766260-38766282 CCCGCTGCTCATCCTCATCCTGG - Intronic
1185151540 22:49166838-49166860 GCTGCTGGTGACCCTCAGGATGG + Intergenic
950405513 3:12801870-12801892 GCTGCTGGTGATTCTGATGCTGG + Intronic
951849804 3:27126557-27126579 GCTGCTGCTGCTGCTGATCCAGG - Intronic
953116858 3:40001446-40001468 GCTGCTGGTGATACTGAGACAGG + Intronic
953457336 3:43053622-43053644 GCTGCGGCTGGTCCACATCCTGG + Exonic
954287286 3:49627971-49627993 GCTGCTGGACCTCCTCAACCAGG - Intronic
954698992 3:52441944-52441966 GCTGCTGGTGCTTCTCTCCCAGG - Intronic
954895601 3:53972562-53972584 GCTGCTGACGAACCTTATCCAGG - Intergenic
955000281 3:54921001-54921023 TGTGCAGGTGATCCTCAGCCGGG + Intronic
955343555 3:58144001-58144023 GCTGCTGGTCCTCTTCTTCCAGG - Intronic
958797890 3:98725830-98725852 TCTGCTGAAGATCCTCTTCCAGG + Intergenic
960532351 3:118779319-118779341 GCTGATGCTGATGCTCAGCCAGG + Intergenic
960687416 3:120307916-120307938 GCTGCTGCTGCTCCTGCTCCAGG - Intergenic
961291176 3:125848231-125848253 GCTGCTGCTGATCTCCTTCCAGG + Intergenic
962775245 3:138652933-138652955 GATGCTGATGCTCCTCATCAGGG + Exonic
968561350 4:1284714-1284736 GCTGCAGGGGGTCCACATCCTGG - Intergenic
968657238 4:1783899-1783921 GCTGCAGGTGACCCCCATCCTGG - Intergenic
969006118 4:4021258-4021280 GCTGCTGCTGATCTCCTTCCAGG - Intergenic
969283985 4:6190998-6191020 GCTGCTGTTTGTCCCCATCCTGG - Intronic
969806830 4:9616032-9616054 GCTGCTGCTGATCTCCTTCCAGG + Intergenic
970001668 4:11371267-11371289 GCTGCAGGTGATCCTAAGGCGGG + Intergenic
971845095 4:31908196-31908218 GCTCCTGGTGAATCTCTTCCCGG - Intergenic
977289592 4:95149695-95149717 GCTGCTGCTGTTCCTCATAATGG + Intronic
981051098 4:140310307-140310329 GCTTCTGCTGCTTCTCATCCGGG + Intronic
983654556 4:170069589-170069611 GCTGCTGGCCATCCTCATTATGG - Intronic
984785881 4:183566904-183566926 GCAGCTGGTGATCTTTCTCCAGG - Intergenic
985643308 5:1073773-1073795 GGTGCTGGTGATGCTGAACCTGG - Exonic
986625920 5:9723730-9723752 GATGCTAGTGACCCTCATCAGGG + Intergenic
988042779 5:25910434-25910456 GCTTCTGGTGCTTCTCCTCCCGG - Intergenic
989754611 5:44937765-44937787 GCTGCTGCTGATACTGCTCCTGG - Intergenic
990347110 5:54882019-54882041 GATGCTGGTGATTCTCTTCCTGG + Intergenic
991125126 5:63061114-63061136 GCTGCAGAGGATCCTCTTCCAGG - Intergenic
992074148 5:73175605-73175627 GCCACTGGTGATGCTCAGCCTGG - Intergenic
993711201 5:91227155-91227177 TATGCTGGTGATCCTCAACCTGG + Intergenic
994844587 5:104971238-104971260 GCTGCTGGTGATTCTTATTTGGG - Intergenic
998790615 5:145762942-145762964 GGTGATGGTGATCCTGGTCCTGG - Intronic
999486457 5:152001906-152001928 GCTGCTGTTGGCCCTCATACAGG - Intergenic
1002193556 5:177490877-177490899 TCTTCAGGTGCTCCTCATCCGGG + Exonic
1004213712 6:13681123-13681145 GATGCATGTGATACTCATCCAGG - Intronic
1004311382 6:14548874-14548896 TCTGCTGGTGATACGCATCATGG + Intergenic
1005941408 6:30562949-30562971 GCTGCTTGTGAAACTCAGCCAGG + Exonic
1007481355 6:42152289-42152311 GCAGTTGGGGATCCACATCCAGG + Intergenic
1010247550 6:73675733-73675755 GCAGCTGGTCATCATCATGCTGG - Intergenic
1014241309 6:119021047-119021069 GATGCTGGTGATGCTGGTCCTGG - Intronic
1014882705 6:126743293-126743315 GCTGCTGGGGATCCTCTAGCTGG + Intergenic
1015408130 6:132860423-132860445 GCTGCTGGTTATCTCCCTCCAGG + Intergenic
1016997078 6:149968270-149968292 GCTGAGGGTCCTCCTCATCCAGG + Intronic
1017001720 6:150001983-150002005 GCTGAGGGTCCTCCTCATCCAGG - Intergenic
1019522840 7:1468396-1468418 GCTCCTGGGGAACCTCCTCCAGG - Intergenic
1020013462 7:4818397-4818419 GCTCCTGGTGCTCCTCCTTCAGG + Intronic
1020326662 7:6979554-6979576 GCTGCTGCTGATCACCTTCCAGG - Intergenic
1022836578 7:34122278-34122300 GCTCCTGGTGATGCTGATGCCGG + Intronic
1024598674 7:50961330-50961352 GATGCTGATGCTGCTCATCCAGG + Intergenic
1025262110 7:57426385-57426407 GGTGATGGTCTTCCTCATCCTGG + Intergenic
1028214417 7:88114175-88114197 GCTCCAGGTGATCCTGATGCAGG - Intronic
1031929230 7:127667546-127667568 GCAGCTGCTGTTCCTGATCCAGG - Intronic
1032282243 7:130513450-130513472 TCTTCTGGTGTTCCTCATTCTGG - Intronic
1033510931 7:142059579-142059601 GATGCGGGTCATCCTCATTCTGG + Exonic
1033513741 7:142085940-142085962 GATGCGGGTCATCCTCATTCTGG + Intronic
1034386892 7:150747707-150747729 GCTGCTGCTGATCCTCCTGGTGG - Intronic
1035678075 8:1468834-1468856 GCTTGTGGTGACCGTCATCCTGG + Intergenic
1036453944 8:8892482-8892504 GCTGGTTGTGATCCACGTCCAGG + Exonic
1038521742 8:28238881-28238903 TCTTCAGGTGTTCCTCATCCAGG - Intergenic
1044613119 8:94113971-94113993 GCTACTGGAGATTCTCGTCCTGG + Intergenic
1046628309 8:116598595-116598617 GCAGCTGGTGCTGCTCTTCCAGG - Intergenic
1047051397 8:121117225-121117247 GCTGCAGGAGGTCCTCTTCCAGG - Intergenic
1049566590 8:143343433-143343455 GCTGCTGGTGACCCACGTGCTGG + Intronic
1049711126 8:144063838-144063860 GCGGCTGGTGCAGCTCATCCAGG - Intergenic
1053000875 9:34576809-34576831 GCTGCTGCCGATCCGCATCGTGG - Intronic
1053421080 9:37978990-37979012 GCTGTTGGTGAGCCTCTCCCAGG - Intronic
1055581538 9:77711474-77711496 GCTGGTGTGGATGCTCATCCTGG + Intergenic
1060477476 9:123997321-123997343 GCTTCTGGGGCTCCTCCTCCTGG - Intergenic
1060960357 9:127676451-127676473 GCTGCTGATGGTCCTCACTCAGG + Intronic
1061648438 9:132026141-132026163 GCTGCTGCTGCTCCTCATTTTGG - Intronic
1062598307 9:137308996-137309018 GCTCCTGGTCATCCTCAGTCGGG - Intronic
1186901650 X:14063783-14063805 GCTTTTGGTGATTCTCATACTGG + Intergenic
1189205683 X:39236695-39236717 GCTGCTTGTAATCCTCACACTGG + Intergenic
1191858018 X:65643272-65643294 GCTTAAGGTGATCCTCTTCCCGG - Intronic
1191869674 X:65735398-65735420 GCTTCTGGTGCTTCTCCTCCCGG - Exonic
1192451928 X:71250094-71250116 GCTGCTGCTGGGCCTCATACAGG + Exonic
1193731610 X:85109320-85109342 GCTGGTGGTTATACTCCTCCAGG - Intergenic
1196117579 X:112014135-112014157 GCTGCTGGTGCTGCTGGTCCAGG + Intronic
1196925409 X:120629403-120629425 CCTGATGGTGATCCTACTCCTGG + Intronic