ID: 1064552955

View in Genome Browser
Species Human (GRCh38)
Location 10:16521074-16521096
Sequence CCTGATCGCCGCCGGGGCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064552955_1064552965 12 Left 1064552955 10:16521074-16521096 CCAGCGCCCCGGCGGCGATCAGG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1064552965 10:16521109-16521131 CCCACCAGCCGGCTCAGCGCGGG 0: 1
1: 0
2: 1
3: 12
4: 180
1064552955_1064552963 11 Left 1064552955 10:16521074-16521096 CCAGCGCCCCGGCGGCGATCAGG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1064552963 10:16521108-16521130 GCCCACCAGCCGGCTCAGCGCGG 0: 1
1: 0
2: 0
3: 11
4: 131
1064552955_1064552960 1 Left 1064552955 10:16521074-16521096 CCAGCGCCCCGGCGGCGATCAGG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1064552960 10:16521098-16521120 GCCTCCTGCTGCCCACCAGCCGG 0: 1
1: 0
2: 3
3: 37
4: 406
1064552955_1064552967 13 Left 1064552955 10:16521074-16521096 CCAGCGCCCCGGCGGCGATCAGG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1064552967 10:16521110-16521132 CCACCAGCCGGCTCAGCGCGGGG 0: 1
1: 0
2: 0
3: 9
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064552955 Original CRISPR CCTGATCGCCGCCGGGGCGC TGG (reversed) Exonic
900344883 1:2205809-2205831 CCAGATCGCCGGCGAAGCGCAGG + Intronic
902044272 1:13513552-13513574 CCCGAGCGCCGCGGCGGCGCAGG + Exonic
903950662 1:26994236-26994258 CCTGAGCGGCGGCGTGGCGCAGG + Exonic
916588270 1:166166532-166166554 CCTGCCCTCCGCCCGGGCGCTGG - Exonic
920655120 1:207868902-207868924 CCGGAGCGCGGCCGGGGCCCTGG + Intergenic
922730806 1:227947998-227948020 CGTGATCCCCTCCCGGGCGCGGG - Intergenic
923673961 1:236064730-236064752 CCCGCTGGCCGCCGGGGCACCGG - Intronic
1063458518 10:6201596-6201618 CCCGGTCGCCGCCTGGGCGCGGG + Intronic
1064552955 10:16521074-16521096 CCTGATCGCCGCCGGGGCGCTGG - Exonic
1065069016 10:22003302-22003324 GCTGCTGGCCGCCGTGGCGCCGG - Exonic
1068538597 10:58267764-58267786 CCATGACGCCGCCGGGGCGCGGG + Exonic
1078318033 11:10307909-10307931 CCTGAGCGCCCGCGGGCCGCTGG + Intergenic
1078579058 11:12524931-12524953 CCTGACCCCCGCCTGGGCGCAGG - Intronic
1083901777 11:65646807-65646829 GCGGGTCGCCGCCGGGGCTCAGG + Exonic
1083933395 11:65857980-65858002 CCTCATCCCGCCCGGGGCGCTGG + Intronic
1084040072 11:66537431-66537453 CCTGAGCCCCTCCGGGGCTCTGG + Intronic
1084180560 11:67443577-67443599 GCTGAGCGGCGCCGGGGGGCCGG + Intronic
1088315003 11:108498390-108498412 CCTCCTCGCCGCCGCGGAGCTGG - Exonic
1106735829 13:32586903-32586925 TCTGATCCCGGCCGGGGCGGCGG + Intronic
1112506994 13:99981408-99981430 CCTGACCGCGGCGGGGGCGCCGG - Intergenic
1119296887 14:73539777-73539799 GCTCATCGCTGCCGGGGCACTGG + Intronic
1119301122 14:73571691-73571713 GCTCATCGCTGCCGGGGCACTGG + Intronic
1119779900 14:77270735-77270757 ACTGGCCGCTGCCGGGGCGCTGG - Intronic
1132591450 16:728029-728051 GGTGAGCGCCGGCGGGGCGCGGG + Exonic
1132809704 16:1791640-1791662 CCTCATCGCTGCCGTGGCCCCGG - Exonic
1132934962 16:2475419-2475441 CCCGATCCCCGCCCGGTCGCTGG + Intronic
1139853716 16:69965251-69965273 CCTGATCCCTGCCCGGGCACTGG + Intergenic
1139882694 16:70188164-70188186 CCTGATCCCTGCCCGGGCACTGG + Intergenic
1140369816 16:74407355-74407377 CCTGATCCCTGCCCGGGCACTGG - Intergenic
1142350076 16:89575765-89575787 CCTGAACGCCTGCCGGGCGCGGG - Exonic
1142625909 17:1191781-1191803 CCTGACGGCAGCCTGGGCGCAGG - Intronic
1143830380 17:9645893-9645915 CCCCATCGCCGGCGGGGAGCTGG - Exonic
1148021769 17:44558111-44558133 TCTGCTCGGCGCCGTGGCGCGGG - Exonic
1149166406 17:53757818-53757840 CCTGGTGGCCGTCGGGGCCCTGG - Intergenic
1151858270 17:76737955-76737977 CCTGACCGCAGCCGCGGCGCCGG - Exonic
1157493039 18:48137048-48137070 CCTGAGCGCCGCCAGGGTCCCGG + Intronic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1158434989 18:57428958-57428980 ACTGAGCCCGGCCGGGGCGCTGG + Intergenic
1160719507 19:591017-591039 CCTCCTCGCAGGCGGGGCGCGGG - Intronic
1160909218 19:1467205-1467227 CCCGAGCGCGGCGGGGGCGCCGG + Exonic
1160960554 19:1718823-1718845 CCTGCTCTCCGCGGGGGCCCGGG + Intergenic
1161689015 19:5720042-5720064 GCTGGCCGCCGCCGGGGGGCGGG - Exonic
1167103836 19:47419310-47419332 GCGCATCGCCGCCGGGGCGGGGG + Intronic
1167357803 19:49014811-49014833 CCTGACCACCCCCAGGGCGCTGG - Intronic
934296834 2:91749089-91749111 CCGGGGCGCCGCCGCGGCGCTGG - Intergenic
937283402 2:120735741-120735763 CCCGAACGCCGCCGGGGCGGGGG - Intronic
948473843 2:238203805-238203827 CCGGCTCGCAGTCGGGGCGCGGG - Intergenic
948487208 2:238288588-238288610 CGTAACCGCCGCCGGCGCGCGGG - Exonic
949019706 2:241734415-241734437 CCTGAGGGCCTCCGGCGCGCCGG - Intergenic
1172146599 20:32762277-32762299 TCAGATCCCCGCCCGGGCGCGGG - Intergenic
1173856063 20:46251451-46251473 CCTGAACGCCGCCCAGCCGCGGG + Exonic
1175997186 20:62817121-62817143 TCTGGCGGCCGCCGGGGCGCAGG + Exonic
1178950388 21:36980834-36980856 CCTGAGCGGGGCTGGGGCGCGGG - Intronic
1180101797 21:45590918-45590940 CCTGAGCACCGCCCGGGTGCAGG + Intergenic
1180181302 21:46119774-46119796 CCTGTTCTCTGCAGGGGCGCAGG + Exonic
1183578217 22:38706023-38706045 CCTGGCCGCCCCCGGGGAGCTGG - Exonic
1184184801 22:42857331-42857353 CCCGTCCACCGCCGGGGCGCAGG + Exonic
1185385786 22:50530828-50530850 CCTGATAGGCGCAGGGGCCCGGG + Exonic
949868344 3:8565626-8565648 CCTCATCGCAGCCGGAGCACCGG - Exonic
968003249 3:195222030-195222052 CCTGATCGCCCCCTTGGAGCAGG - Intronic
968642471 4:1721502-1721524 CTTGATGGCCGCCGGCGCGCCGG - Intronic
968965230 4:3766192-3766214 CCGGAGCCCAGCCGGGGCGCAGG - Intergenic
970636957 4:18021120-18021142 CCTTGTCGCCGCCGGGGGCCGGG - Intronic
971230981 4:24800079-24800101 CCTGGTTGCCGCCGCGGCCCAGG - Exonic
975689587 4:76950308-76950330 CCTGAGCGCCCCCTCGGCGCGGG - Intronic
983877756 4:172896837-172896859 CCTGATTGCCGCAGGAGAGCTGG + Intronic
991686897 5:69189720-69189742 GCTGCACGCCGCCTGGGCGCCGG - Exonic
996308542 5:122077768-122077790 CCTCAGCGCCGCCGGGACCCGGG - Exonic
1001065208 5:168530119-168530141 CCAGATCGCGGCCGGCGCGGTGG - Exonic
1003176083 6:3752662-3752684 CCAGAGCGCTGCCGGGGCGGGGG - Intergenic
1010703244 6:79077577-79077599 CGGGGTCCCCGCCGGGGCGCGGG - Intronic
1019337992 7:494241-494263 CCCGCCCGCCCCCGGGGCGCCGG + Intergenic
1020796799 7:12686830-12686852 CCCGCGCGCCGCCCGGGCGCCGG - Intergenic
1021729961 7:23586428-23586450 CTTCATCGCCGCGGGGGTGCTGG - Intergenic
1025017106 7:55448750-55448772 CCAGCTCGCTGCCAGGGCGCTGG + Intronic
1029539321 7:101173478-101173500 CGTGATCGACGCCGGGGAGACGG - Exonic
1033220572 7:139524172-139524194 TCTGACCGCCTCCGGGTCGCGGG - Intronic
1035588920 8:798447-798469 CCTGGTCAGCGCCGGGGCACGGG - Intergenic
1054870477 9:70043962-70043984 GCTGCTCAGCGCCGGGGCGCTGG + Exonic
1062101641 9:134731602-134731624 CCCGATCTCCGACGGGGAGCTGG - Exonic
1062162502 9:135087921-135087943 CCTGAAGGCCGCCTGGGCGCGGG + Exonic
1062542744 9:137048785-137048807 CCTGATCCCCGCCGACCCGCCGG - Exonic
1062708682 9:137960040-137960062 CCTGAGGGACGCCGGGGCGGGGG + Intronic
1203772465 EBV:56518-56540 CCTGATCTCCGCCCGAGAGCAGG + Intergenic
1203793927 EBV:166141-166163 CCGGATCCCCGCCGGGGCTAGGG - Intergenic
1187826284 X:23335257-23335279 CCCGACCGCGGCCGCGGCGCTGG - Intronic