ID: 1064555726

View in Genome Browser
Species Human (GRCh38)
Location 10:16545479-16545501
Sequence CCCACAGGAAATGCTGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064555719_1064555726 -5 Left 1064555719 10:16545461-16545483 CCTGATACCTGGAAGAGCCCCAC No data
Right 1064555726 10:16545479-16545501 CCCACAGGAAATGCTGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064555726 Original CRISPR CCCACAGGAAATGCTGGAGT GGG Intergenic
No off target data available for this crispr