ID: 1064557660

View in Genome Browser
Species Human (GRCh38)
Location 10:16563530-16563552
Sequence CTGCAAAACTAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064557656_1064557660 5 Left 1064557656 10:16563502-16563524 CCTTGACAACATAAAAATAGTAA No data
Right 1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG No data
1064557654_1064557660 26 Left 1064557654 10:16563481-16563503 CCATAATGAAAACCTTATAAACC No data
Right 1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG No data
1064557655_1064557660 14 Left 1064557655 10:16563493-16563515 CCTTATAAACCTTGACAACATAA No data
Right 1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064557660 Original CRISPR CTGCAAAACTAGAAGGAGGA GGG Intergenic
No off target data available for this crispr