ID: 1064559149

View in Genome Browser
Species Human (GRCh38)
Location 10:16578675-16578697
Sequence CAGAATAACATGGAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064559149_1064559157 20 Left 1064559149 10:16578675-16578697 CCTGCCTCCTCCATGTTATTCTG No data
Right 1064559157 10:16578718-16578740 CCCATGAACAAGGCTACTCAAGG No data
1064559149_1064559155 10 Left 1064559149 10:16578675-16578697 CCTGCCTCCTCCATGTTATTCTG No data
Right 1064559155 10:16578708-16578730 GCTTTTGATGCCCATGAACAAGG No data
1064559149_1064559159 21 Left 1064559149 10:16578675-16578697 CCTGCCTCCTCCATGTTATTCTG No data
Right 1064559159 10:16578719-16578741 CCATGAACAAGGCTACTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064559149 Original CRISPR CAGAATAACATGGAGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr