ID: 1064559155

View in Genome Browser
Species Human (GRCh38)
Location 10:16578708-16578730
Sequence GCTTTTGATGCCCATGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064559148_1064559155 15 Left 1064559148 10:16578670-16578692 CCTCACCTGCCTCCTCCATGTTA No data
Right 1064559155 10:16578708-16578730 GCTTTTGATGCCCATGAACAAGG No data
1064559152_1064559155 3 Left 1064559152 10:16578682-16578704 CCTCCATGTTATTCTGGCAGTTC No data
Right 1064559155 10:16578708-16578730 GCTTTTGATGCCCATGAACAAGG No data
1064559149_1064559155 10 Left 1064559149 10:16578675-16578697 CCTGCCTCCTCCATGTTATTCTG No data
Right 1064559155 10:16578708-16578730 GCTTTTGATGCCCATGAACAAGG No data
1064559147_1064559155 16 Left 1064559147 10:16578669-16578691 CCCTCACCTGCCTCCTCCATGTT No data
Right 1064559155 10:16578708-16578730 GCTTTTGATGCCCATGAACAAGG No data
1064559151_1064559155 6 Left 1064559151 10:16578679-16578701 CCTCCTCCATGTTATTCTGGCAG No data
Right 1064559155 10:16578708-16578730 GCTTTTGATGCCCATGAACAAGG No data
1064559153_1064559155 0 Left 1064559153 10:16578685-16578707 CCATGTTATTCTGGCAGTTCTAG No data
Right 1064559155 10:16578708-16578730 GCTTTTGATGCCCATGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064559155 Original CRISPR GCTTTTGATGCCCATGAACA AGG Intergenic
No off target data available for this crispr