ID: 1064565529

View in Genome Browser
Species Human (GRCh38)
Location 10:16635474-16635496
Sequence GCAGCATGGTAGGCTGCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064565529_1064565540 24 Left 1064565529 10:16635474-16635496 CCCTTAGCAGCCTACCATGCTGC 0: 1
1: 0
2: 1
3: 6
4: 112
Right 1064565540 10:16635521-16635543 TGTCGCTGGGACTCTGGCCAAGG No data
1064565529_1064565534 11 Left 1064565529 10:16635474-16635496 CCCTTAGCAGCCTACCATGCTGC 0: 1
1: 0
2: 1
3: 6
4: 112
Right 1064565534 10:16635508-16635530 CTGCCTTTTCCCCTGTCGCTGGG No data
1064565529_1064565536 18 Left 1064565529 10:16635474-16635496 CCCTTAGCAGCCTACCATGCTGC 0: 1
1: 0
2: 1
3: 6
4: 112
Right 1064565536 10:16635515-16635537 TTCCCCTGTCGCTGGGACTCTGG No data
1064565529_1064565533 10 Left 1064565529 10:16635474-16635496 CCCTTAGCAGCCTACCATGCTGC 0: 1
1: 0
2: 1
3: 6
4: 112
Right 1064565533 10:16635507-16635529 TCTGCCTTTTCCCCTGTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064565529 Original CRISPR GCAGCATGGTAGGCTGCTAA GGG (reversed) Intronic
901456577 1:9366462-9366484 GCAGCATGGTTAGTGGCTAAGGG + Intronic
902707167 1:18213513-18213535 GCAGCATGGGAGGTTTCTAGGGG + Intronic
904213243 1:28899483-28899505 GCATCATCGGAGGCTGCAAAAGG - Intronic
904233187 1:29094566-29094588 ACAGCATGGTAGGCTGGGCATGG - Intronic
907517369 1:55001043-55001065 GCAGCGTGGTGGGCTGAAAATGG + Intronic
910954011 1:92681896-92681918 GAAACATGGTAGGGTGCTAGGGG - Intronic
913478266 1:119260026-119260048 GATGCATGGTAGACTACTAATGG - Intergenic
915682812 1:157597938-157597960 GCAGCATGGAAGCCTGCTCCAGG + Exonic
921028111 1:211308625-211308647 GAAACATGGTAAGCTGCTTATGG - Intronic
921205791 1:212847579-212847601 GCTGTATGGTAGTATGCTAAAGG - Exonic
923590174 1:235310915-235310937 GCAGTTTGGTAGGCTGATATGGG - Intronic
1064565529 10:16635474-16635496 GCAGCATGGTAGGCTGCTAAGGG - Intronic
1067142637 10:43669586-43669608 GCAGCGTGGCAGGCTGCTGGGGG + Intergenic
1070954767 10:80456327-80456349 GCAGAATGGTTGGCTGCCCAGGG + Intronic
1074195210 10:111178120-111178142 GCAGCATGGGAAGATTCTAAAGG + Intergenic
1074677376 10:115867473-115867495 GCAGCCTGGCAGGCTGCTTAGGG + Intronic
1080226110 11:29962526-29962548 GCAACATGATTGGCTGGTAAAGG - Intergenic
1082109853 11:48262551-48262573 GGAGCATGGTGGGGAGCTAAAGG + Intergenic
1083543670 11:63533228-63533250 ACAGGATGGTAGGCTGTAAAAGG - Intergenic
1090663153 11:128895822-128895844 GGAGCAGGGAAGGCTTCTAAGGG + Intronic
1093430596 12:19080824-19080846 GCTGCATGTTTGGCTTCTAAAGG + Intergenic
1095145548 12:38721884-38721906 GCAGCAGGGTGGGCAGCTCAGGG - Intronic
1098430742 12:70417361-70417383 GCAGCATTGGAGGCTCCTCAAGG + Intronic
1099519514 12:83642781-83642803 GCAGCATGCTAGGCTGGGATAGG - Intergenic
1099602560 12:84760255-84760277 ACAGCATGGTAATCTGGTAAAGG - Intergenic
1101820580 12:108181150-108181172 GCAGCATGTCAGGTTCCTAAGGG - Intronic
1101987105 12:109455907-109455929 CCAGCAAGGTAGGGAGCTAAAGG + Intronic
1102275009 12:111575198-111575220 GCAGTCTGGTATGTTGCTAAGGG - Intronic
1102632189 12:114290792-114290814 GGAGCAGGGCAGGCTGCTCATGG - Intergenic
1105446928 13:20465621-20465643 GCAGCTTGGCAGGCTCCAAAAGG + Intronic
1113031124 13:105994687-105994709 ACAGCATGATAGGCTGCAACAGG - Intergenic
1118123011 14:62867185-62867207 ACAGCATGGGAGGCTGCAAAAGG + Intronic
1119710656 14:76820461-76820483 GCAGCATGAGAGGCTGTTGAGGG + Intronic
1121273619 14:92653224-92653246 GCTGCAAGGTAGGCTGCTAATGG + Intronic
1123052965 14:105556027-105556049 GCAGCCAGGTAGGCAGCTGAAGG - Intergenic
1123077548 14:105676417-105676439 GCAGCCAGGTAGGCAGCTGAAGG - Intergenic
1124950523 15:34315309-34315331 GCTGCAGGGTGGGCTGCTGAAGG - Intronic
1127322714 15:57863307-57863329 GCAACATGGTAGGATGAGAAGGG + Intergenic
1132418586 15:101643959-101643981 GCTGCGTGGTAGGCTGCAATGGG - Intronic
1134829431 16:17311329-17311351 GCAGCCTCGTGGGCTGCTCATGG + Intronic
1138992476 16:62408781-62408803 GCAGCATGCTAGTATGCTAGTGG + Intergenic
1144550162 17:16233676-16233698 GCAGCATGGTACACAGCCAAGGG - Intronic
1144769374 17:17751110-17751132 CCTGCATGGAGGGCTGCTAAGGG - Intronic
1145982493 17:29021376-29021398 GCAGCAGGATAAGCTGATAAAGG - Intronic
1147387366 17:40090376-40090398 GCAGCAGGGCAGGCTGGTGAGGG - Intronic
1151153674 17:72109484-72109506 TGAGCTTGGTAGTCTGCTAAGGG - Intergenic
1154335365 18:13460956-13460978 GCAGCATGGCAGGCTGTTCCAGG - Intronic
1156133640 18:34008647-34008669 GCATCATGGCGGGCTGGTAAAGG - Intronic
1156450698 18:37264739-37264761 GCAGCAGGGTAGGCAGCTGCTGG + Exonic
1160473578 18:79162234-79162256 ACAGCATGGTGGGTTGCTCATGG + Intronic
1161583560 19:5093324-5093346 GCAGCATGGAAGGCTGCGGAAGG + Intronic
1167982098 19:53283993-53284015 GTGGCATGGTAGGATGCTACGGG - Intergenic
1167984048 19:53299980-53300002 GTGGCATGGTAGGATGCTACGGG + Intergenic
925110841 2:1335363-1335385 GCAGCGTGGTTGGCTGCTGACGG - Intronic
926474403 2:13304257-13304279 GAAGCATGCTAGGCTGCTCTGGG - Intergenic
930167692 2:48219492-48219514 GCAGGGTGGTAGGCAGCTCAGGG - Intergenic
930331233 2:49987187-49987209 GCAGAATTGTAGGCTGGGAAAGG - Intronic
934987445 2:98898014-98898036 GCAGCTGGGGAAGCTGCTAAGGG + Intronic
935479598 2:103569578-103569600 GCTGAATGGTAGGCTGGAAAAGG - Intergenic
936448275 2:112614467-112614489 ACAGCATGCGAGCCTGCTAAGGG - Intergenic
938096332 2:128466596-128466618 GCAGCAGGGTAGGCAGCTCCGGG + Intergenic
940134360 2:150419280-150419302 GCAGGAGGGGATGCTGCTAAGGG + Intergenic
940893044 2:159054008-159054030 GCAGCATGGGATGCTGCTCTAGG + Intronic
945822512 2:214681872-214681894 AGAGGATGGTAGGATGCTAATGG + Intergenic
1169995656 20:11553320-11553342 CCACCATGGTAGGCCGATAATGG - Intergenic
1170747313 20:19111845-19111867 GCAAGATGATAGGATGCTAAGGG + Intergenic
1171439543 20:25149035-25149057 GCAGCCAGGTCGGCTGCGAAAGG + Intergenic
1177260742 21:18725880-18725902 ACAGCATGCTTGGGTGCTAATGG - Intergenic
1178600298 21:33988667-33988689 GCAGCAAGGGAGGCTGGAAAAGG + Intergenic
1179010959 21:37555842-37555864 GCAGCATGTTAGCCTTTTAAAGG - Intergenic
1184052847 22:42021365-42021387 TCAGTGTGGTAGGCTGATAATGG + Intronic
1184417438 22:44360461-44360483 GCAGCAGGGTGGGCTGGGAAGGG + Intergenic
950869138 3:16213702-16213724 CCAGCAGTGTGGGCTGCTAAGGG - Intronic
950914507 3:16630755-16630777 GCAGTATGTTAGATTGCTAAAGG + Intronic
951482318 3:23174540-23174562 GCTGCACAGTTGGCTGCTAATGG + Intergenic
953207879 3:40848049-40848071 CCAGCATGGCAGTCTGCTAATGG - Intergenic
954389078 3:50259587-50259609 GCAGCTGGGCAGGCTTCTAAGGG + Intergenic
960582262 3:119290793-119290815 GCACCATGACAGTCTGCTAAAGG + Intergenic
961628311 3:128278888-128278910 GCAGCATTGGAGGCTGCAAGGGG - Intronic
965581188 3:170269413-170269435 GCAGTTTGGGAGGCTGCGAAGGG + Intronic
969628870 4:8323733-8323755 GCAGTTTGGGAGGCTGCTACAGG - Intergenic
970612966 4:17742719-17742741 GCAGAAAGGGAGGCTGCCAACGG - Intronic
972312449 4:37893396-37893418 GCAGCACGGTAGACTGGAAAAGG - Intronic
974761705 4:66285174-66285196 GCAGCATGGCAGGCAGCTCCAGG + Intergenic
976113947 4:81706471-81706493 ACAGCATGGTAGGATGAAAATGG - Intronic
978866084 4:113513147-113513169 GCACCCAGGTAGACTGCTAATGG + Intronic
979235965 4:118400570-118400592 GCAGCAGGATAAGCTGATAAAGG - Intergenic
984219742 4:176958773-176958795 GCAGCATGATAGGATGATAGGGG - Intergenic
986576742 5:9220873-9220895 GCCGCATGGTGGGATGCAAAGGG + Intronic
992007868 5:72496262-72496284 GGAGCAAGATCGGCTGCTAATGG - Intronic
993180549 5:84546985-84547007 ACAGCATGTTTGTCTGCTAATGG - Intergenic
995646717 5:114320996-114321018 GGAGCATGGGAGGATTCTAAGGG - Intergenic
996073049 5:119156785-119156807 GGAGCCTGGTACACTGCTAATGG - Intronic
997160623 5:131605738-131605760 GCAGCAAGCTAGGCTGGTCACGG + Intronic
999334828 5:150706476-150706498 GCTGCTTGGTAGGCTGGTAGCGG + Intergenic
1001115070 5:168932609-168932631 GCAGCCTGGTGGGCAGCCAATGG + Intronic
1002920008 6:1561417-1561439 GCAGCATCAGAGGCTGCTCAGGG - Intergenic
1008202150 6:48603749-48603771 GCAGCATGGCAATCTGCTATGGG + Intergenic
1011682741 6:89798876-89798898 ACAGAATGGTAGGAAGCTAAAGG - Intronic
1022156034 7:27662771-27662793 GCAGCATGGCAGCCTCCTTACGG - Exonic
1023257010 7:38322428-38322450 GCAGCATGCAAGGCTGCGCAGGG + Intergenic
1023990533 7:45125827-45125849 ACAGCATGTTAAGCTGTTAACGG - Intergenic
1028054427 7:86225317-86225339 GCAGCGTGGTAGGCAGCTCCAGG + Intergenic
1029667263 7:102003684-102003706 GCAGCCTCGTAGGTTGCTATGGG + Intronic
1033583455 7:142756946-142756968 GTTGCATGGTAGGTTGCTATGGG - Intronic
1040448684 8:47522444-47522466 GCAGCAGGAAAGGCTGCTGAAGG + Intronic
1043549112 8:81348931-81348953 GCAGCAAGGCAGGCTGGAAATGG + Intergenic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1057612994 9:96563220-96563242 ACAGCATGGAGGGCTGCTATGGG + Intronic
1058091885 9:100814305-100814327 GCACCATGGATGGCTGCTAAAGG + Intergenic
1059705869 9:116822747-116822769 GTAGAGTGGTAGGCTGATAATGG + Intronic
1189665512 X:43350831-43350853 GAAGGAGGGTAGCCTGCTAAAGG - Intergenic
1190390556 X:49927014-49927036 GGAGCATGGGAGGCAGCTGATGG + Intronic
1192189011 X:68979335-68979357 GCACCAGGGTAGTCTGCTCAAGG + Intergenic
1192300526 X:69896733-69896755 GCAGCATGGTATGGTGGAAAGGG - Intronic
1193951282 X:87802547-87802569 GCAGCAATGTAGGTTGCCAAAGG + Intergenic
1197452155 X:126632744-126632766 GAAGCATAGTGGGCTGCTGAGGG - Intergenic
1198106948 X:133470865-133470887 CCACCATGGTCGGCTGCTCAGGG + Intergenic
1199720658 X:150540913-150540935 GCAGCATGGTAGAATGCCAGGGG - Intergenic
1200120117 X:153786181-153786203 GCAGCAGGGTAGGGTGCGAGGGG + Intronic