ID: 1064566883

View in Genome Browser
Species Human (GRCh38)
Location 10:16648873-16648895
Sequence ATGCTTTTATAGTTGTGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064566883_1064566884 9 Left 1064566883 10:16648873-16648895 CCAAGTCACAACTATAAAAGCAT 0: 1
1: 0
2: 1
3: 13
4: 159
Right 1064566884 10:16648905-16648927 AGTCATTAGCAGATGACTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064566883 Original CRISPR ATGCTTTTATAGTTGTGACT TGG (reversed) Intronic
900879348 1:5369372-5369394 ATACTTTTATAGTGCTGGCTGGG + Intergenic
905895300 1:41541868-41541890 ATGGTTGTATACTTATGACTTGG + Intronic
909065211 1:70927929-70927951 ATGATTTTTAAGTTGTGCCTTGG + Intronic
910836019 1:91511349-91511371 AGGTAATTATAGTTGTGACTGGG - Intronic
911268700 1:95774912-95774934 ATGTTTTTTTAGTTGTGAGGAGG - Intergenic
915050773 1:153070212-153070234 ATGCATATATATTTGTGAATGGG - Exonic
915207092 1:154278189-154278211 AAGCTTTTGTTGTTGTGATTGGG - Intergenic
917006507 1:170421362-170421384 ATGCATATATATTTGAGACTGGG + Intergenic
917178370 1:172264253-172264275 ATGTTTTTATTTTTGTCACTAGG - Intronic
918641584 1:186847646-186847668 ATGCTTTTATAACTGTGAAGTGG - Intronic
919374292 1:196773748-196773770 ATGTTTTTAAAGTTGTGTTTTGG - Intergenic
921090047 1:211833601-211833623 ATGTTTTTATAATTGCCACTAGG - Intergenic
921445081 1:215236364-215236386 ATACTTTTGGAGTTGTGACTTGG + Exonic
924545976 1:245028355-245028377 ATGCTGCTGTAATTGTGACTGGG + Intronic
1064566883 10:16648873-16648895 ATGCTTTTATAGTTGTGACTTGG - Intronic
1065730065 10:28702294-28702316 GTGATTTTATAGTTCTGACTTGG + Intergenic
1067546335 10:47195047-47195069 AGGCTTTTAAAGAGGTGACTAGG + Intergenic
1070992999 10:80749168-80749190 ATGTTTTGATAGTTCTGACCTGG - Intergenic
1073840020 10:107487883-107487905 ATGCATTTATAGATTTGTCTGGG - Intergenic
1074437011 10:113442697-113442719 GTGATTTCATACTTGTGACTGGG + Intergenic
1077645659 11:3921373-3921395 ATTCCTTTATAGTTTTGCCTAGG + Intronic
1079050280 11:17149875-17149897 ATTCTTTAATGGTTATGACTAGG - Intronic
1079946404 11:26747452-26747474 AAGCTTTTAGCATTGTGACTGGG + Intergenic
1080310599 11:30887398-30887420 ATGCTTTTTTAGTTTTAAATTGG + Intronic
1084419408 11:69052866-69052888 CTGCTTTTTCAGTTGAGACTCGG - Intronic
1087853489 11:103061257-103061279 ATGTTTCTGAAGTTGTGACTGGG + Intergenic
1091548677 12:1521469-1521491 ATGCTTGTACAGTTGTCTCTGGG + Intergenic
1091562841 12:1628120-1628142 ATTCTTTAGTAGTAGTGACTAGG - Intronic
1092643721 12:10546481-10546503 AGACTTTTATGGCTGTGACTTGG - Intergenic
1094492305 12:30968617-30968639 ATATTTTTAGAGTTGTGAATGGG + Intronic
1094714726 12:33001385-33001407 ATAGTTTTATAGTGGTGAGTGGG + Intergenic
1095207310 12:39453518-39453540 ATACTTTTTTAGTTATGACATGG + Intergenic
1095551340 12:43444216-43444238 ATGCTTTTATATTTTATACTGGG + Intronic
1096378033 12:51130628-51130650 AGGCTTTTATAGTTATCATTTGG - Intronic
1097622184 12:61953035-61953057 ATACTTTTATAGTCTTGCCTTGG - Intronic
1098440775 12:70515054-70515076 TTGCTTTTAAACTTGTGTCTTGG + Intergenic
1099489129 12:83266895-83266917 CTACTTTTATAATTTTGACTTGG + Intergenic
1100693986 12:97070705-97070727 ATGCTAGTATAGTTGTTCCTAGG + Intergenic
1101326642 12:103721480-103721502 ATTTTTTTCCAGTTGTGACTAGG + Intronic
1102144069 12:110641397-110641419 ATGTATTTATAGTTCTGAGTAGG + Intronic
1108346250 13:49549779-49549801 TTGCTTTTGTTGCTGTGACTTGG - Intronic
1109526126 13:63579429-63579451 ATGCTTTCATACCTGAGACTGGG + Intergenic
1109623925 13:64949426-64949448 ATGTTTATATAGTTGTGAAAAGG - Intergenic
1110772354 13:79364433-79364455 ATGATTTTTTAATTCTGACTAGG + Intronic
1111788314 13:92819623-92819645 ATGTTTTTCTAGTTTTCACTAGG + Intronic
1115206767 14:30915741-30915763 ATGTTTGTATAATTGTGAGTGGG - Intronic
1116916533 14:50531829-50531851 ATGCTTTTATTGTTGCCTCTTGG - Intronic
1118261281 14:64249199-64249221 ATGCATTTATACTTATGTCTGGG - Intronic
1120912197 14:89677343-89677365 ATGGTGGTATAGTTGTCACTTGG + Intergenic
1121834923 14:97083523-97083545 ATTTTTTTATAGTAGAGACTGGG + Intergenic
1122197388 14:100098916-100098938 ATGCTAATAGAGTTGTTACTAGG - Intronic
1127786643 15:62361447-62361469 ATGCTGTTCCAGTTGTGAATCGG - Intergenic
1129766447 15:78172359-78172381 ATGCTTTGATGGTTGTGATGGGG + Intronic
1129937473 15:79462923-79462945 ATGCTTTCATACTTTTGATTTGG + Intronic
1133825631 16:9275739-9275761 ATGCTGTTAGAGTTGAGCCTAGG + Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1142729485 17:1842722-1842744 ATGTTTTTATAGTTGGTATTTGG - Intronic
1143601666 17:7950499-7950521 ATGCTTATATAGCTGTCAGTGGG + Intergenic
1144309127 17:13996508-13996530 TTTCTTTTTCAGTTGTGACTGGG - Intergenic
1144345302 17:14344379-14344401 AGGCTTCTAGAGTTGTGTCTTGG + Intronic
1146285356 17:31570949-31570971 ATGCATTTATCGTTTTGACAAGG - Intergenic
1147471695 17:40668312-40668334 GAGCTTATATAGTTGTGACCTGG + Intergenic
1148525629 17:48330482-48330504 TTCTTTTTAGAGTTGTGACTTGG - Intronic
1150598399 17:66627633-66627655 TCGGTTTTATAGCTGTGACTGGG - Intronic
1150815129 17:68386660-68386682 CTGCTTTTATAGGGCTGACTTGG + Intronic
1155995137 18:32323270-32323292 ATGCTGTTGTATTTGTGAATGGG + Intronic
1158734076 18:60059889-60059911 TTGCTATTATAGTTTTGATTTGG + Intergenic
1158988124 18:62840019-62840041 ATGCTTTCATATTTTTGAATTGG + Intronic
1163224571 19:15949011-15949033 ATGATGCTATAGTTCTGACTAGG - Exonic
927715448 2:25349090-25349112 ATGCATTTTTAGTTGTGGATGGG - Intergenic
929520354 2:42644493-42644515 ATGCTATTATAGGTGTGGCCTGG + Intronic
930242586 2:48951900-48951922 ATGCTTTTTGAGTTCTGACTAGG + Intergenic
933210083 2:79556345-79556367 AAGATTTTATAGTGGTGACTTGG + Intronic
934940617 2:98499078-98499100 GTGCTTTTATAATTTTGAGTGGG - Intronic
935388608 2:102526479-102526501 CTTCTTTTATAGTTGAAACTCGG + Intronic
936902352 2:117496306-117496328 CAGCTCTTAGAGTTGTGACTTGG - Intergenic
937404560 2:121614977-121614999 TTGTTTATATAGTTTTGACTTGG - Intronic
939743686 2:145942772-145942794 ATGCTTTTATGCTGTTGACTTGG + Intergenic
940259865 2:151768455-151768477 ATGTTTTTCTTGTTGTGCCTGGG + Intergenic
942271780 2:174282636-174282658 TTGCTTTTCTAATTGTGAATGGG + Intergenic
943234544 2:185300692-185300714 ATGCTTTTACAGGAGTGACCAGG + Intergenic
945379654 2:209125175-209125197 ATGCTGTTTTAGTTGTGAGGTGG + Intergenic
946503500 2:220274942-220274964 CTGCTTTTATAGCTGTCTCTAGG + Intergenic
946745833 2:222844930-222844952 ATGTTTTTATATTTGTGTGTGGG + Intergenic
1170108628 20:12780326-12780348 ATGTTTTTATAGTTGTAAGTTGG - Intergenic
1174873789 20:54207159-54207181 ATGCCTTTGCTGTTGTGACTAGG - Intergenic
1179052951 21:37904663-37904685 ATGCTTTGATAGAAGTCACTGGG - Intronic
1181827728 22:25532260-25532282 ATCATTTTATAGATTTGACTCGG + Intergenic
1184495083 22:44836188-44836210 TTGCATTTAGAGTTGTGATTTGG - Intronic
951705467 3:25540073-25540095 ATCCTTTTACAGTTGTCACTCGG - Intronic
951844232 3:27068343-27068365 ATCCTGGTATAGTTATGACTTGG - Intergenic
951986401 3:28626489-28626511 ATGTTTATATAGTTGTGTATGGG + Intergenic
953210982 3:40875161-40875183 GTGCTCTCATGGTTGTGACTTGG + Intergenic
955473833 3:59314714-59314736 ATGCCTTTGTAGTTGAGACTAGG + Intergenic
955862499 3:63346266-63346288 ATGATTGTGTATTTGTGACTTGG - Intronic
957396692 3:79648434-79648456 GTGTTTTTATAGTTGTGATCAGG - Intronic
957758637 3:84525222-84525244 TTGCTTATATTTTTGTGACTAGG + Intergenic
958002276 3:87765455-87765477 ATGCTTATAAAGTTATGACTGGG - Intergenic
960566639 3:119139617-119139639 ATGGACTTAGAGTTGTGACTGGG - Intronic
962088584 3:132218796-132218818 ATTCTTTTGTAGGTGTGAATAGG - Intronic
962121019 3:132560035-132560057 ATCCTGTTTTAGTGGTGACTTGG - Intronic
963299575 3:143583716-143583738 ATGCTTATCTAGTTCTTACTGGG - Intronic
964483668 3:157165338-157165360 AATCCTTTATAATTGTGACTAGG - Intergenic
966057963 3:175719019-175719041 ATGCTTTTTTAGTTGCGATTGGG + Intronic
966250940 3:177864598-177864620 ATACTTTTAAATTTATGACTTGG - Intergenic
966559960 3:181309180-181309202 ATGCTTTTATAGTCAGGAATTGG - Intergenic
967783864 3:193468834-193468856 ATGACTTTCTAGTTCTGACTTGG + Intronic
970608594 4:17705463-17705485 ATGCTTTGCTTGTTTTGACTGGG + Intronic
970778032 4:19701063-19701085 TGGCTTTTATATTTGTGAATGGG - Intergenic
971996604 4:33973479-33973501 ATCCTTTCATAGTTGTGTGTGGG - Intergenic
972873980 4:43335311-43335333 ATGCATTTATAGTTTTGAAGAGG + Intergenic
973538999 4:51916320-51916342 ATGTTTTTATAAATCTGACTAGG + Exonic
974258584 4:59494905-59494927 TAGCTATTAGAGTTGTGACTAGG - Intergenic
981320157 4:143382453-143382475 TTGCTTTTGTATTTGGGACTTGG + Intronic
982722881 4:158877520-158877542 ATGCTTTTAGAGTTATGATAAGG + Intronic
987845670 5:23280445-23280467 ATTTTTTTTTAATTGTGACTAGG + Intergenic
988083746 5:26446182-26446204 ATGCTTTTTAAGTTATTACTTGG + Intergenic
989128027 5:38075803-38075825 GTTCTTTCATAGATGTGACTAGG - Intergenic
989290958 5:39765272-39765294 ATGCTTTTATAGTGCTCACAAGG + Intergenic
989406172 5:41063710-41063732 ATGTTTTTAGAGTTGAAACTGGG + Intronic
990648790 5:57875099-57875121 ATCCTTTGCTATTTGTGACTAGG + Intergenic
990724283 5:58736173-58736195 ATGCTGTTAAGGTTGTGGCTAGG - Intronic
990844139 5:60118418-60118440 ATGCTTTTCAATTTGTGCCTGGG + Intronic
990875157 5:60476123-60476145 ATGATTTTACAGTTATTACTTGG - Intronic
995821524 5:116239694-116239716 ATGCTTAAATAGTTATGACAGGG - Intronic
996845743 5:127896864-127896886 ATGTTTTTATAATGGTGACTAGG + Intergenic
997051584 5:130387389-130387411 AAGCTTTTGGAGTTGTGAGTAGG - Intergenic
998388071 5:141769610-141769632 AGGCTTTTAAAGCTGTCACTGGG + Intergenic
998675082 5:144398198-144398220 TTGATTTTCTAGTAGTGACTAGG + Intronic
998989214 5:147796668-147796690 TTCCTTTTATAGTTATGAGTTGG - Intergenic
999211678 5:149894921-149894943 CTACTTTTATACTTGTGACATGG + Intronic
1002972925 6:2042790-2042812 AGGCTTTGTTAGTTGTTACTGGG - Intronic
1003034072 6:2627843-2627865 TTGCTTTCACAGTTGGGACTAGG - Intronic
1005403218 6:25457003-25457025 ATGCTTTTATAAATGAGACCAGG - Intronic
1007886363 6:45234674-45234696 ATGCTATAAGGGTTGTGACTAGG - Intronic
1008471794 6:51892696-51892718 ATGCTTTAATAGTCTTTACTAGG + Intronic
1011170392 6:84498444-84498466 TTGTTTTTTTAGTTTTGACTAGG - Intergenic
1011265847 6:85518145-85518167 ATACTTTTACAGTTTTAACTTGG - Intronic
1011420104 6:87162905-87162927 ATGCTCTTATAGTTGTAAAATGG + Intronic
1011736507 6:90315779-90315801 CTGCTTTGATAGTTGAGACTCGG - Intergenic
1012336746 6:98069103-98069125 ATGCTGTTATAATTGTGCTTTGG + Intergenic
1012443780 6:99288132-99288154 ATGCATTTTTTGTTGTGATTTGG - Intronic
1014026375 6:116651330-116651352 ATGCTTTCATAGCTGTTTCTTGG - Intronic
1018524398 6:164691889-164691911 ATGATTTTATAATTATGACTGGG + Intergenic
1022145821 7:27539429-27539451 ATGCTTTTATCCTGGTCACTAGG - Intronic
1022987601 7:35674085-35674107 AAATTGTTATAGTTGTGACTTGG - Intronic
1023365721 7:39461198-39461220 GTGCTTTTAAAGCTGTGTCTGGG - Intronic
1024113988 7:46174739-46174761 ATGTTTTTATATATGTAACTTGG - Intergenic
1024988764 7:55218782-55218804 TTGCTTTTTTAGTTGAGACGGGG + Intronic
1025640547 7:63363551-63363573 ATGGTTTTTGAGGTGTGACTGGG + Intergenic
1025642152 7:63384542-63384564 ATGGTTTTTGAGGTGTGACTGGG - Intergenic
1028263398 7:88692053-88692075 TTCCATTTATAGTTTTGACTTGG - Intergenic
1030172163 7:106614006-106614028 ATGCTTTTGGTGTTGTAACTAGG + Intergenic
1031343134 7:120629809-120629831 ATGCTTTTAAAGTTTTTAGTCGG + Intronic
1031691038 7:124788072-124788094 ATACTTTTCTTGTTGTGAATTGG + Intronic
1033043458 7:137939405-137939427 ATGCTTTTTGAATTGTAACTTGG + Intronic
1034824885 7:154252841-154252863 AGGTTTTTATAGTTATGTCTAGG - Intronic
1035311434 7:157971957-157971979 CTGCTTTCATAGTTCTCACTTGG - Intronic
1036021212 8:4848714-4848736 ATATTTTTATAGTAGGGACTGGG + Intronic
1037632545 8:20671577-20671599 ATTTTTTTATATTTGTAACTAGG + Intergenic
1039044866 8:33440588-33440610 ATGCTGTAATAGTTATGATTTGG - Intronic
1041777540 8:61540026-61540048 GTGCTTTGATAGTTGTGATTTGG + Intronic
1042789254 8:72585100-72585122 ATGATTTAATACTTGTGACATGG + Intronic
1046313275 8:112466538-112466560 ATGCTAATGTAGTTTTGACTTGG - Intronic
1047755016 8:127911782-127911804 ATGGTTCTTTTGTTGTGACTAGG + Intergenic
1052065913 9:24019743-24019765 ATATTTTTATAGTTGTTATTGGG + Intergenic
1053067075 9:35076344-35076366 CTGCTTTTGTTCTTGTGACTTGG - Intronic
1058308227 9:103469859-103469881 CAGTTTTTATAGTGGTGACTTGG + Intergenic
1061934352 9:133849211-133849233 ATGCTATTATACTTGGGACAGGG + Intronic
1186772487 X:12831357-12831379 ATGCTTTTTTAGTTGTGATTGGG - Intergenic
1187213462 X:17252527-17252549 ATGCGTATATAGGTGTGGCTGGG - Intergenic
1188217356 X:27494642-27494664 GTGCTTTTGTGGTTATGACTTGG + Intergenic
1193928370 X:87520082-87520104 ATGGTTTTATAGGTGTGCCAAGG + Intronic
1201958340 Y:19650431-19650453 ATGCTTTTTTAATTATGCCTGGG - Intergenic