ID: 1064567906

View in Genome Browser
Species Human (GRCh38)
Location 10:16661696-16661718
Sequence CAAAGCTAGCACATTCAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064567906_1064567910 16 Left 1064567906 10:16661696-16661718 CCCCTTTGAATGTGCTAGCTTTG 0: 1
1: 0
2: 0
3: 13
4: 150
Right 1064567910 10:16661735-16661757 TCCAACTGCAACCAAACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064567906 Original CRISPR CAAAGCTAGCACATTCAAAG GGG (reversed) Intronic
903965661 1:27087672-27087694 AACAGATGGCACATTCAAAGGGG - Intergenic
905749858 1:40452599-40452621 CAAGGCTCACACATTCAAAGTGG - Intronic
906431521 1:45759445-45759467 GAAAGCCAGGACATTCTAAGAGG - Intergenic
909300566 1:74008378-74008400 CAAAACTAGATCATTCAGAGGGG - Intergenic
910122603 1:83807029-83807051 CAAAGCAAGGACTTTCAAATGGG + Intergenic
911475595 1:98368179-98368201 CAGAGCTAGCACTCTCAATGGGG + Intergenic
912604122 1:110970831-110970853 CAAAGCTAACACAAGCAATGGGG + Intergenic
915671249 1:157490725-157490747 TAAAGCCAGCACCTTCAGAGTGG - Intergenic
917811487 1:178662705-178662727 CGAAGCAAGCACATTCAAGGTGG + Intergenic
920102552 1:203526407-203526429 GAAAGCTACCAGAGTCAAAGAGG + Intergenic
922727474 1:227929459-227929481 CAAACCTAACACCATCAAAGTGG + Intronic
924021158 1:239785078-239785100 CAAAGCTGGCACATGGATAGTGG - Intronic
1064554104 10:16531378-16531400 CAGTGCTTGCATATTCAAAGAGG - Intergenic
1064567906 10:16661696-16661718 CAAAGCTAGCACATTCAAAGGGG - Intronic
1065023700 10:21521915-21521937 TAAATCTAGCACATTCATATGGG - Intronic
1065127314 10:22586040-22586062 CAATGTTAGAACATTCAAAAAGG - Intronic
1067011792 10:42721021-42721043 GATAGCTAACACATTCAACGTGG - Intergenic
1068042940 10:51849802-51849824 CAAACTTATCACATTCAAACAGG + Intronic
1070594847 10:77825420-77825442 CAAAGCTAGCATATTGACATTGG - Intronic
1071379865 10:85047692-85047714 AAGAGCTTGCACTTTCAAAGTGG + Intergenic
1074825101 10:117209055-117209077 AAAAGCCAGCACCTTCACAGAGG + Intronic
1077839855 11:5962001-5962023 CACAGCTAGCATATTCAACAAGG - Intergenic
1078044259 11:7898988-7899010 TAGAGCTAGCACCTTTAAAGTGG - Intergenic
1079382490 11:19950137-19950159 AACAGCTAGAACATTCAAGGTGG - Intronic
1079513425 11:21238049-21238071 CAAACCTAGCACAACCAAACAGG + Intronic
1079795625 11:24799295-24799317 CACAGCTATTAAATTCAAAGGGG + Intronic
1081746462 11:45475986-45476008 CACAGGTAGAACATTCAAAAGGG - Intergenic
1085193149 11:74646800-74646822 CAAGGCTCTGACATTCAAAGTGG - Intronic
1085452300 11:76641968-76641990 CAAAGCTACTACATTCAAGAAGG - Intergenic
1085932193 11:81097168-81097190 CATAGCTATCACATTTAAACAGG + Intergenic
1086557731 11:88131582-88131604 GAGATCAAGCACATTCAAAGTGG - Intronic
1088009577 11:104983876-104983898 CAATCCTACCACATTCCAAGAGG + Intergenic
1088035051 11:105301212-105301234 CATAGCTCCCATATTCAAAGAGG + Intergenic
1089777661 11:120849812-120849834 CAAAGTTAGCACCTTAAAACAGG + Intronic
1090892603 11:130938887-130938909 CAAAGAAAGCAGATTCTAAGAGG - Intergenic
1091831911 12:3556088-3556110 CAAACCTAACACATGCAAAAAGG - Intronic
1094338705 12:29386991-29387013 CAAAGTCAGCACATCCAAAATGG + Intergenic
1095417548 12:41993049-41993071 GAAACAGAGCACATTCAAAGGGG + Intergenic
1098889179 12:75991451-75991473 AAAAGCCATCCCATTCAAAGGGG - Intergenic
1099397410 12:82157998-82158020 CTACCCTAGAACATTCAAAGAGG - Intergenic
1099591999 12:84604699-84604721 CAAATCCAGCACACTCCAAGGGG + Intergenic
1101046316 12:100810032-100810054 CAAAGCCATCCCATTCAAATGGG + Intronic
1105573310 13:21624485-21624507 CAAAGCAGACACATGCAAAGGGG - Intergenic
1110888827 13:80672918-80672940 AAAAGATAGAACATTCAAAGCGG - Intergenic
1110979759 13:81881198-81881220 CATAGCTATCCCAATCAAAGAGG - Intergenic
1113645842 13:111994992-111995014 CAACGCTGGCACATTAAAAAAGG - Intergenic
1113776562 13:112950023-112950045 TAAAGCTAGCAAGTTCAAAAAGG + Intronic
1114405170 14:22449742-22449764 GAAAGCTGGCACTGTCAAAGGGG - Intergenic
1115229768 14:31147392-31147414 ATAACCTAGCACATTCAAACAGG + Intronic
1115452661 14:33566033-33566055 CAGAGCTTCCACATTCAAAAGGG - Intronic
1118187787 14:63553069-63553091 CAGACCTAACACATTCTAAGGGG + Intergenic
1118414614 14:65522188-65522210 CAAAGCTAGTACTGTCAAACAGG - Intronic
1118819606 14:69336419-69336441 CACAGCTGGCAAGTTCAAAGAGG - Intronic
1119126108 14:72128664-72128686 CAGAGCCAGCACAGTCATAGTGG + Intronic
1119207761 14:72807464-72807486 CAAAACTAGCCGAGTCAAAGGGG - Intronic
1131932780 15:97463737-97463759 AAAAGCATGCACATTCTAAGTGG + Intergenic
1138617429 16:58181058-58181080 CATGGCTTGAACATTCAAAGGGG + Intronic
1138773350 16:59690938-59690960 CAAAGCTAACACAGTTATAGGGG + Intergenic
1138843275 16:60535271-60535293 GAAAGAAAGCACATTCAAACAGG - Intergenic
1139225300 16:65228775-65228797 CAAAGCAACCTCATTCATAGTGG + Intergenic
1141335883 16:83154878-83154900 AAAAGCTCTCATATTCAAAGTGG + Intronic
1144143518 17:12374231-12374253 TAAAGCTTACAAATTCAAAGAGG - Intergenic
1145822938 17:27854040-27854062 GAAAGCAAGCACATTTAAAAAGG - Intronic
1147440053 17:40442683-40442705 CAAAACTTGCACATTGCAAGTGG + Intergenic
1147889717 17:43708774-43708796 CACAGCTAGCAAATTGGAAGAGG - Intergenic
1154200946 18:12300281-12300303 CAGAGCTTTCTCATTCAAAGAGG - Intergenic
1155471695 18:26198715-26198737 GAAACCTAGCAAAGTCAAAGAGG + Intergenic
1156580460 18:38369032-38369054 CAAAGCAAGGACATTCCAAGAGG - Intergenic
1156737325 18:40276259-40276281 CATAGCAAGTACAATCAAAGAGG - Intergenic
1163181246 19:15605246-15605268 AAAAGTTAGCAGATTTAAAGTGG + Intergenic
1164870918 19:31641993-31642015 CAAATCCAGCTCATTCAAGGCGG - Intergenic
1167064611 19:47175062-47175084 CAAAGTTAGCACATTAGAAGTGG + Intronic
1167197688 19:48041936-48041958 CACAGCTAACTCATTCAGAGTGG + Intronic
929629915 2:43448944-43448966 GAAAGATAGCCAATTCAAAGGGG + Intronic
931007542 2:57869140-57869162 CAGAGGTAGCACTTTCAAAAAGG + Intergenic
931492157 2:62759915-62759937 GAAACCAAGGACATTCAAAGTGG - Intronic
933632951 2:84677190-84677212 CAAGGCTCCCACAATCAAAGTGG + Intronic
937580010 2:123473837-123473859 CAAAGGCAGGACACTCAAAGAGG - Intergenic
938574342 2:132589964-132589986 CAGAACTAGCACATTCATGGGGG - Intronic
938807464 2:134819740-134819762 CAAAGCTAACACAATCAGAGGGG + Intergenic
938826661 2:135012428-135012450 CAAAGCTAAAATATTCAAATAGG + Intronic
941027388 2:160472549-160472571 AAAAAATAGCACATGCAAAGAGG - Intronic
944212134 2:197217523-197217545 CAAAAATAGCACATTCAATTGGG + Intronic
944823097 2:203451477-203451499 CAGAGGTAGCAGATTCAAAGGGG - Intronic
945644487 2:212473325-212473347 CAAAGCTGGCACATAAAAAGAGG + Intronic
947416721 2:229904097-229904119 CAAAGCTAGCATTTTTAAAAAGG + Intronic
947570743 2:231232323-231232345 CAAATTTATCACATTCTAAGAGG + Intronic
1172567978 20:35945911-35945933 TAATCCTAGCACTTTCAAAGTGG + Intronic
1175180833 20:57146009-57146031 CACAACTACCACATCCAAAGAGG + Intergenic
1177473466 21:21588793-21588815 TAAAGCTAGGACATTCAGAACGG + Intergenic
1177503120 21:21984718-21984740 CAAAGCAAACACAAGCAAAGTGG + Intergenic
1179325696 21:40341629-40341651 CAAAACCAGCACATCCTAAGAGG - Intronic
1180164314 21:46014083-46014105 GGAAGCGAGCACATGCAAAGGGG + Intergenic
1182258393 22:29054530-29054552 CAAAGCCAGGACAACCAAAGGGG - Exonic
1182727015 22:32455818-32455840 CCCAGAAAGCACATTCAAAGAGG + Intronic
954737602 3:52719062-52719084 GAAAGCAAGCACTTTTAAAGGGG - Intronic
959034527 3:101345643-101345665 CAAAGCAAACACAAACAAAGTGG + Intronic
960416977 3:117396927-117396949 CAAAGCTATCACAATCAACTGGG + Intergenic
962143555 3:132816770-132816792 CAAAGCTTGCACTTTTAATGAGG + Intergenic
963316896 3:143768986-143769008 CAAAGATAGCAAATGCAAATGGG - Intronic
964743026 3:159987718-159987740 CAAACCCAGCACATCCAAAATGG + Intergenic
965005663 3:163019347-163019369 CAAGACTACCACCTTCAAAGAGG + Intergenic
965638894 3:170812480-170812502 CCACGCCAGCAGATTCAAAGAGG - Intronic
968038962 3:195572504-195572526 GAAAGCAGGCTCATTCAAAGAGG - Intronic
970010838 4:11457265-11457287 GAAAGCCATGACATTCAAAGAGG + Intergenic
971054769 4:22899543-22899565 CAAAGGGAACACATTCAAACAGG + Intergenic
971891561 4:32529967-32529989 CAGAGCCAGCACAATCATAGTGG + Intergenic
972135087 4:35882769-35882791 CAAAGCCAGCACTTGCCAAGAGG - Intergenic
978610680 4:110535447-110535469 CAAAGCTTGCACATTCCATGAGG - Intronic
978647981 4:110963808-110963830 AAAACCTAGCACATCCCAAGAGG + Intergenic
981223714 4:142267319-142267341 CAAAGTTATCATAATCAAAGTGG + Intronic
981769594 4:148292933-148292955 CAAGGCTAGCACAGGGAAAGGGG + Intronic
984907896 4:184647551-184647573 CACAGCACGCACATTCACAGTGG + Intronic
987123677 5:14791649-14791671 CAAAGCTGTCAAATTCAATGAGG - Intronic
987185528 5:15413828-15413850 CAAAGCAAGCAAAAACAAAGCGG + Intergenic
990388654 5:55295089-55295111 CAAGGCTGGAACATCCAAAGTGG - Intronic
992654426 5:78894290-78894312 GAAAGCTAGCACATTCTATCTGG + Intronic
993079935 5:83283502-83283524 CAAACCTAGAACATTAAAACAGG + Intronic
993169678 5:84402132-84402154 CAAAACAAGCACACTGAAAGTGG + Intergenic
993341885 5:86734799-86734821 CAAAGCTATTACATTTAATGAGG - Intergenic
993643283 5:90432115-90432137 CAAAGCTAGCATATTGTAAGAGG + Intergenic
994352262 5:98759783-98759805 CAAAACTTGCACATACAAACTGG + Intergenic
996236403 5:121136028-121136050 CAAAGCAAGCTCATTTAAATTGG - Intergenic
997046372 5:130323796-130323818 CCAAGGTAGTAAATTCAAAGAGG - Intergenic
997641299 5:135450563-135450585 AACAGCTAGCACATTCCGAGTGG + Intronic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
1000629710 5:163578654-163578676 CCTAGCAAGCACATTCAAAGAGG + Intergenic
1003518231 6:6835442-6835464 TAAATCAAGCACATTTAAAGTGG + Intergenic
1004780510 6:18903247-18903269 AAAAGCTAGCTCTTTCACAGCGG - Intergenic
1009934252 6:70214798-70214820 CAAAACTACCACATTCCAAATGG - Intergenic
1010737738 6:79461557-79461579 CAAAGATATGACATTCTAAGGGG + Intergenic
1010950627 6:82033046-82033068 CAGAGCCATCACCTTCAAAGTGG + Intergenic
1012414473 6:98998114-98998136 CAAAGCATTCACATTAAAAGAGG - Intergenic
1015019313 6:128453088-128453110 TATAGCTAGCATTTTCAAAGTGG - Intronic
1015282962 6:131453650-131453672 CATGGCTAGCACATAAAAAGGGG + Intergenic
1022772666 7:33491294-33491316 CAAAGCTACCACATTAAATGTGG + Intronic
1024832930 7:53482815-53482837 CCAAGATAGAACATTCCAAGAGG - Intergenic
1028449437 7:90964283-90964305 CAAAGTTATCACAATCAAAATGG - Intronic
1028578314 7:92378580-92378602 AAAAGCTAGCATATTTAATGAGG + Intronic
1028654595 7:93189823-93189845 CAGAGCTGGCACATTCAAGTTGG + Intronic
1029803085 7:102970437-102970459 CAAAGGTAACAAATTCAAATTGG - Intronic
1031028599 7:116710370-116710392 CAAAGCAGGCACATATAAAGCGG - Intronic
1035966533 8:4198198-4198220 CCAAGGTAGCAAATACAAAGAGG + Intronic
1038143714 8:24874191-24874213 CAAAGCAAGCAAAAACAAAGAGG + Intergenic
1040646097 8:49398964-49398986 TAATGCTAAGACATTCAAAGTGG + Intergenic
1046784496 8:118251622-118251644 AAAAGCAAGCACCTTCAATGGGG + Intronic
1050166688 9:2771862-2771884 CATGGCTATCTCATTCAAAGAGG - Intronic
1050948437 9:11557206-11557228 CAAAGAGAGAACTTTCAAAGTGG - Intergenic
1057333427 9:94138134-94138156 CAAAGCTAGCTTATGGAAAGAGG + Intergenic
1058566079 9:106286903-106286925 CAAAGCTAGCATAGTCACTGTGG + Intergenic
1058928356 9:109691330-109691352 CATAGGTAGAATATTCAAAGAGG - Intronic
1059502006 9:114762798-114762820 CAAAGCTAAGCCTTTCAAAGGGG - Intergenic
1060059611 9:120447422-120447444 CAGAGCCAGCAGGTTCAAAGAGG + Intronic
1185779493 X:2832008-2832030 CAATGCTACTGCATTCAAAGAGG - Intronic
1194561656 X:95428681-95428703 CAAACCTAGCACAGTCATAGTGG + Intergenic
1194757506 X:97754827-97754849 CAAAACCAGAAGATTCAAAGTGG - Intergenic
1195283452 X:103359208-103359230 GAATTCTAGCACATTCACAGTGG - Intergenic
1196259244 X:113558690-113558712 CAGAGATAGCACATTGAAAATGG - Intergenic
1196596366 X:117550347-117550369 CAAATTTAGCACGTTCAAAAGGG - Intergenic
1197156006 X:123271140-123271162 TCAAGTTAGCACATTCAGAGAGG - Intronic
1197156672 X:123277684-123277706 CAAAGGTCTCACATTCAAAATGG + Intronic
1197302298 X:124796085-124796107 CCATGCCATCACATTCAAAGAGG + Intronic
1198968527 X:142253132-142253154 GAACTCTAGCACATTCAAAATGG - Intergenic
1199614318 X:149644581-149644603 CAGAGCTAGCATGTCCAAAGAGG + Intergenic