ID: 1064568318

View in Genome Browser
Species Human (GRCh38)
Location 10:16666701-16666723
Sequence GTGCCACCGCACCCGGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1918
Summary {0: 1, 1: 5, 2: 60, 3: 375, 4: 1477}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064568318_1064568323 5 Left 1064568318 10:16666701-16666723 CCATCAGCCGGGTGCGGTGGCAC 0: 1
1: 5
2: 60
3: 375
4: 1477
Right 1064568323 10:16666729-16666751 TGTAATCTCAGCACTTTGGGAGG 0: 17059
1: 309863
2: 262289
3: 146890
4: 133936
1064568318_1064568327 18 Left 1064568318 10:16666701-16666723 CCATCAGCCGGGTGCGGTGGCAC 0: 1
1: 5
2: 60
3: 375
4: 1477
Right 1064568327 10:16666742-16666764 CTTTGGGAGGCTAAGGTGGGTGG 0: 1088
1: 47434
2: 122993
3: 199535
4: 173944
1064568318_1064568325 14 Left 1064568318 10:16666701-16666723 CCATCAGCCGGGTGCGGTGGCAC 0: 1
1: 5
2: 60
3: 375
4: 1477
Right 1064568325 10:16666738-16666760 AGCACTTTGGGAGGCTAAGGTGG 0: 2398
1: 119370
2: 202468
3: 127652
4: 75874
1064568318_1064568321 2 Left 1064568318 10:16666701-16666723 CCATCAGCCGGGTGCGGTGGCAC 0: 1
1: 5
2: 60
3: 375
4: 1477
Right 1064568321 10:16666726-16666748 ACCTGTAATCTCAGCACTTTGGG 0: 4917
1: 91486
2: 314751
3: 239094
4: 147836
1064568318_1064568328 29 Left 1064568318 10:16666701-16666723 CCATCAGCCGGGTGCGGTGGCAC 0: 1
1: 5
2: 60
3: 375
4: 1477
Right 1064568328 10:16666753-16666775 TAAGGTGGGTGGATTACTTGAGG No data
1064568318_1064568320 1 Left 1064568318 10:16666701-16666723 CCATCAGCCGGGTGCGGTGGCAC 0: 1
1: 5
2: 60
3: 375
4: 1477
Right 1064568320 10:16666725-16666747 CACCTGTAATCTCAGCACTTTGG 0: 4646
1: 81750
2: 216607
3: 252973
4: 200794
1064568318_1064568324 11 Left 1064568318 10:16666701-16666723 CCATCAGCCGGGTGCGGTGGCAC 0: 1
1: 5
2: 60
3: 375
4: 1477
Right 1064568324 10:16666735-16666757 CTCAGCACTTTGGGAGGCTAAGG 0: 316
1: 15294
2: 191037
3: 294652
4: 197836
1064568318_1064568326 15 Left 1064568318 10:16666701-16666723 CCATCAGCCGGGTGCGGTGGCAC 0: 1
1: 5
2: 60
3: 375
4: 1477
Right 1064568326 10:16666739-16666761 GCACTTTGGGAGGCTAAGGTGGG 0: 1401
1: 64912
2: 227581
3: 275572
4: 180438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064568318 Original CRISPR GTGCCACCGCACCCGGCTGA TGG (reversed) Intronic
900086287 1:899310-899332 GAGCCACCGCGCCCGGCTGGGGG + Intergenic
900135415 1:1115410-1115432 GTGCCCCCACTCCCGGCTGCCGG + Intronic
900236081 1:1591540-1591562 GAGCCACCGCGCCCGGCCGATGG + Intergenic
900360410 1:2285848-2285870 GAGCCACCGCACCAGCCAGAAGG + Intronic
900423785 1:2567133-2567155 GAGCCACCACACCCGGCTTCAGG + Intergenic
900832383 1:4974490-4974512 GAGCCACCGCGCCCGGATGCCGG - Intergenic
900871801 1:5309493-5309515 GTGCCACTGCGCCCAGCCGATGG + Intergenic
901071714 1:6523293-6523315 GAGCCACCGCACCCGGCTGGTGG - Exonic
901099954 1:6712339-6712361 GAGCCACCGCGCCCGGCCGATGG + Intergenic
901169103 1:7242642-7242664 GAGCCACCACGCCTGGCTGAAGG - Intronic
901256874 1:7836461-7836483 GAGCCACTGCACCCGGCCTATGG + Intronic
901258214 1:7850252-7850274 GAGCCACCGCACCCAGCAAAAGG + Intronic
901440712 1:9276379-9276401 GAGCCACTGCACCCGGCCCAAGG - Intergenic
901487929 1:9578200-9578222 GAGCCACCGCACCCGGCCTCTGG + Intronic
901525167 1:9816929-9816951 GAGCCACCGCACCCAGCCGGTGG + Intronic
901528622 1:9839980-9840002 GAGCCACCCCACCCAGCTGACGG - Intergenic
901571933 1:10167871-10167893 GAGCCACCACGCCCGGCAGATGG + Intronic
901574352 1:10188850-10188872 GAGCCACCGCACCCGGCCTGCGG + Intergenic
901579337 1:10227898-10227920 GAGCCACAGCACCCGGCTGAGGG - Intronic
901695499 1:11004709-11004731 GAGCCACCGCACCCGGCCAGTGG + Intergenic
901729811 1:11271249-11271271 GAGCCACCGCACCCGGCGGGAGG - Intergenic
901745300 1:11368956-11368978 GAGCCACCGCGCCCGGCTTTCGG - Intergenic
901812079 1:11773175-11773197 GAGCCACCGCACCCGGCCTGTGG + Intronic
901828381 1:11877721-11877743 GAGCCACTGCACCCGGCCAAAGG + Intergenic
901840893 1:11953338-11953360 GAGCCACCGTGCCCGGCTGTCGG + Intronic
901851368 1:12018138-12018160 GAGCCACCGCCCCGGGCCGAAGG + Intergenic
902006337 1:13235240-13235262 GAGCCACCGCGCCCGGCCGGGGG + Intergenic
902086287 1:13865405-13865427 GAGCCACCGCACCCAGCCCAAGG - Intergenic
902087657 1:13875602-13875624 GAGCCACCACGCCCGGCTGGGGG - Intergenic
902315040 1:15612401-15612423 GAGCCACTGCACCCAGCCGATGG + Intergenic
902594112 1:17496318-17496340 GAGCCACCGCACCCGGCCCATGG + Intergenic
902777393 1:18683553-18683575 GAGCCACCGCACCCGGCCAATGG - Intronic
902894245 1:19467951-19467973 GAGCCACTGCGCCTGGCTGAGGG - Intronic
902902106 1:19524927-19524949 GAGCCACTGCACCCAGCTGGTGG - Intergenic
902975870 1:20088071-20088093 GAGCCACCGCGCCCGGCCCATGG - Intronic
903036600 1:20497049-20497071 GCCCCACCGCACCCGGCTCATGG - Intergenic
903124989 1:21241707-21241729 GAGCCACCGCACCCGGCCTGAGG + Intronic
903161105 1:21489682-21489704 GAGCCACCGCACCCGGCCAGGGG - Intergenic
903562553 1:24238720-24238742 GAGCCACCACACCCAGCTGAGGG + Intergenic
903605820 1:24574401-24574423 GAGCCACCGCGCCCGGCCAACGG + Intronic
903745038 1:25581217-25581239 GTGCCCCCGCCCCAGGCTGCTGG - Intergenic
903854808 1:26330821-26330843 GAGCCACCACACCTGGCTGGTGG + Intronic
903882580 1:26521687-26521709 GAGCCACCGCGCCCGGCCAAGGG + Intergenic
903894091 1:26591613-26591635 GAGCCACCGCGCCCGGCGAAGGG - Intergenic
903903857 1:26669138-26669160 GAGCCACCACACCTGGCTAATGG + Intergenic
903932893 1:26874051-26874073 GAGCCACCGCGCCCGGCCAAGGG + Intergenic
903947539 1:26973109-26973131 GAGCCATCGGACCCGGCTGAAGG - Intergenic
904076285 1:27845104-27845126 GAGCCACCGTGCCCGGCCGAGGG - Intronic
904105755 1:28081039-28081061 GAGCCACTGCGCCCGGCCGATGG + Intronic
904115888 1:28161629-28161651 GAGCCACTGCACCCAGCTGGTGG + Intronic
904238030 1:29126325-29126347 GAGCCACCGCACCCGGCCACAGG - Intergenic
904688578 1:32276926-32276948 GAGCCACCGCGCCCGGCTGGAGG - Intronic
904745452 1:32707921-32707943 GAGCCACCACACCCAGCTGTGGG - Intergenic
904828063 1:33288449-33288471 CCACCACCGCACCCGGCTGGTGG - Intronic
905148981 1:35912071-35912093 GAGCCACCGCGCCCGGCCGAAGG - Intronic
905413818 1:37791348-37791370 GAGCCGCCGCACCCGGCAAATGG + Intergenic
905425042 1:37876724-37876746 CCGCCACCACACCCGGCTAATGG - Intronic
905425295 1:37878932-37878954 GAGCCACCGCACCCAGCCTATGG + Intronic
905486646 1:38302039-38302061 GAGCCACCGCACCCGGCTGAGGG + Intergenic
905526515 1:38644152-38644174 GAGCCACCGCGCCCGGCCTAGGG + Intergenic
905557073 1:38894987-38895009 GAGCCACCGCACCCGGCCAAGGG + Intronic
905573565 1:39025637-39025659 GAGCCACTGCGCCCGGCTGGGGG + Intergenic
905654095 1:39674952-39674974 GAGCCACCGCACCCGGCCCGGGG - Intergenic
905877739 1:41443709-41443731 GAGCCACCGCACCCAGCCCAAGG + Intergenic
905934408 1:41812285-41812307 GAGCCACTGCACCCGGCCCATGG - Intronic
906284639 1:44578879-44578901 GAGCCACCGCACCCGGCCTGAGG - Intronic
906325689 1:44843826-44843848 GAGCCACCGCGCCCGGCCTAGGG + Intergenic
906495673 1:46302659-46302681 GGGCCACCGAACCTGACTGATGG - Intronic
906672563 1:47667150-47667172 GAGCCACTGCACCCGGCTGATGG + Intergenic
907198828 1:52708762-52708784 GAGCCACCACACCCGGCCCAGGG - Intergenic
907216186 1:52866219-52866241 GAGCCACCGCACCCGGCCAAGGG + Intronic
907254407 1:53167634-53167656 GAGCCACCGCACCTGGCCTATGG - Intergenic
907434012 1:54432337-54432359 GAGCCACTGCATCCGGCTGAGGG - Intergenic
907727555 1:57033995-57034017 GAGCCACCGCGCCCGGCCGAGGG - Intronic
907797042 1:57728307-57728329 GAGCCACCGCACCCGGCCAGGGG - Intronic
907843217 1:58176693-58176715 GAGCCACCGCGCCCGGCTGGAGG - Intronic
908258451 1:62320822-62320844 GAGCCACCGTGTCCGGCTGATGG - Intergenic
908361431 1:63371885-63371907 GAGCCACCGCACCCAGCTAGAGG + Intronic
908454904 1:64294114-64294136 GAGCCACCGTGCCCGGCCGAAGG - Intergenic
908529831 1:65023765-65023787 GAGCTACTGCACCCTGCTGAGGG + Intergenic
908897006 1:68911863-68911885 GAGCCACCGCGCCCGGCAGCCGG - Intergenic
909162661 1:72173290-72173312 GAGCCACCACACCAGCCTGAAGG + Intronic
909248505 1:73321835-73321857 ATGCCACCACACCCTGCTAACGG + Intergenic
909479815 1:76119103-76119125 GAGCCACTGCACCTGGCCGATGG + Intronic
909766335 1:79360640-79360662 GAGCCACCGCGCCCGGCCAACGG - Intergenic
910014731 1:82507679-82507701 GAGCCACCACACCCGGCCAATGG + Intergenic
910256885 1:85257818-85257840 GAGCCACCGCTCCCGGCCGAAGG - Intronic
910400973 1:86837987-86838009 GAGCCACCGCGCCCGGCCAATGG + Intergenic
910420683 1:87058775-87058797 GAGCCACCGCACCCAGCCAACGG - Intronic
910514662 1:88046701-88046723 GAGCCACCGCACCCGGCCTGGGG - Intergenic
910573025 1:88727453-88727475 GAGCCACTGCACCCGGCCCAAGG + Intronic
910745176 1:90566299-90566321 GAGCCACCGCACCCGGCCTGTGG - Intergenic
911079995 1:93919227-93919249 GAGCCACCACACCCAGCTGAAGG + Intergenic
911283545 1:95960837-95960859 GAGCCACTGCACCCAGCTAAAGG + Intergenic
912050086 1:105518558-105518580 GAGCCACCGCGCCCGGCCAAGGG + Intergenic
912520939 1:110244212-110244234 GTGCCACCGCACCCGAGTTAGGG - Intronic
912815187 1:112823228-112823250 GAGCCACCGTGCCCGGCCGATGG - Intergenic
912838292 1:113016294-113016316 GAGCCACCGCACCTGGCCAAAGG + Intergenic
912858734 1:113194098-113194120 GAGCCACCACACCCGGCCGAGGG + Intergenic
913202410 1:116505631-116505653 GAGCCACCGCACCTGGCTTCTGG + Intergenic
913275457 1:117133708-117133730 GAGCCACCGCACCCGGCCAGTGG - Intergenic
913516498 1:119609817-119609839 GAGCCACCGCGCCCGGCTTGTGG + Intergenic
913612610 1:120523220-120523242 GAGCCACCGCACCCGGCTGGAGG - Intergenic
913647878 1:120878091-120878113 GTGCCACCACGCCCAGCTAAAGG - Intergenic
913660009 1:120998695-120998717 GAGCCACCGCACCCGGCCTGTGG - Intergenic
914003065 1:143709024-143709046 GAGCCACTGCACCCGGCCCAGGG + Intergenic
914011368 1:143781851-143781873 GAGCCACCGCACCCGGCCTGTGG - Intergenic
914078750 1:144384757-144384779 GTGCCACCACGCCCAGCTAAAGG + Intergenic
914100429 1:144581745-144581767 GTGCCACCACGCCCAGCTAAAGG - Intergenic
914166465 1:145179283-145179305 GAGCCACCGCACCCGGCCTGTGG + Intergenic
914224876 1:145712082-145712104 GAGCCACCGTGCCCGGCCGAGGG - Intergenic
914578581 1:148999028-148999050 GAGCCACCGCACCCGGCTGGAGG + Intronic
914649989 1:149690491-149690513 GAGCCACCGCACCCGGCCTGTGG - Intergenic
914710225 1:150206394-150206416 GTGCCACCACACCCGGCTAATGG - Intergenic
914759700 1:150588583-150588605 GAGCCACTGCGCCAGGCTGAGGG - Intergenic
914832193 1:151178477-151178499 GTGCCAGCACACCCAGCTGTAGG - Intronic
915217578 1:154350351-154350373 GAGCCACCACACCCAGCTCAGGG + Exonic
915237425 1:154494496-154494518 GAGCCACCGGGCCCGGCAGATGG + Intronic
915342165 1:155182554-155182576 GAGCCACCGCATCCGGCTAAGGG - Intronic
915403064 1:155637942-155637964 GAGCCACTGCACCCGGCCAAGGG + Intergenic
915460519 1:156068035-156068057 GAGCCACCGCGCCTGGCCGAGGG + Intronic
915521257 1:156445767-156445789 GAGCCACCGCGCCCGGCCGAGGG + Intergenic
916044955 1:160992629-160992651 GAGCCACCGTGCCCGGCTCAAGG - Intergenic
916047285 1:161009681-161009703 GAGCCACCGCACCCGGCCCATGG - Intronic
916077598 1:161211157-161211179 GAGCCACCACACCCGGCCTATGG + Intronic
916400119 1:164438608-164438630 GAGCCACCGCGCCCAGCTCAAGG - Intergenic
916601470 1:166297511-166297533 GAGCCACTGCGCCCGGCCGAGGG + Intergenic
916778299 1:167993463-167993485 GAGCCACCGCGCCCGGCCAAAGG - Intronic
917554064 1:176066008-176066030 GAGCCACCGCACCTGGCCGGGGG + Intronic
917810998 1:178658381-178658403 GAGCCACCGCACCCAGCCTAAGG + Intergenic
918033346 1:180839937-180839959 GAGCCACCGCGCCCGGCCGAGGG - Intronic
918050420 1:180968410-180968432 GAGCCACCGTGCCCAGCTGATGG - Intergenic
918214421 1:182380963-182380985 GAGCCACTGCACCCGGCCTAGGG - Intergenic
918300766 1:183201623-183201645 GAGCCACCGCACCCAGCCAAGGG - Intronic
918317581 1:183334792-183334814 GAGCCACCGCACCTGGCCCAAGG + Intronic
918401596 1:184168183-184168205 GAGCCACCGCACCTGGCCTATGG + Intergenic
918546816 1:185693911-185693933 GTGTCACTGCACCCGGTTCAAGG + Intergenic
918602651 1:186381609-186381631 GAGCCACCGCGCCCGGCCTAAGG + Intronic
918803182 1:189000027-189000049 GTGCCACCACCCCCGGCTGGGGG + Intergenic
919002176 1:191847028-191847050 GAGCCACCGCACCTGGCCAAAGG - Intergenic
919029928 1:192228188-192228210 GAGCCACCGCACCCGGCCCCCGG + Intergenic
919689750 1:200518438-200518460 GAGCCACTGCACCTGGCTTATGG + Intergenic
919997725 1:202768996-202769018 GAGCCACTGCACCCGGCCTACGG + Intronic
920239153 1:204531543-204531565 GAGCCACCACACCCAGCTAAGGG - Intronic
920240021 1:204539995-204540017 GAGCCACCGCGCCCGGCTAATGG - Intronic
920279991 1:204835511-204835533 GAGCCACTGCGCCCGGCTGGTGG + Intronic
920317954 1:205092712-205092734 GAGCCACTGCACCCAGCTCAAGG + Intronic
920328883 1:205190338-205190360 GAGCCACTGCACCTGGCTGAAGG - Intronic
920789303 1:209073381-209073403 GAGCCACCGCACCCGGCTCTGGG + Intergenic
920934231 1:210416224-210416246 GTCCCACAGCACCCTGATGATGG + Intronic
921032175 1:211343569-211343591 GAGCCACCACACCTGGCTGAGGG + Intronic
921128389 1:212197969-212197991 GAGCCACTGCGCCCGGCCGATGG - Intergenic
921214616 1:212926509-212926531 GTGCCACGGCGCCTGGCTGGAGG + Intergenic
921234262 1:213108932-213108954 GAGTCACCACACCTGGCTGAAGG + Intronic
921336105 1:214088084-214088106 GAGCCACTGCACCCGGCCAAGGG - Intergenic
921342666 1:214149978-214150000 GAGCCACTGCACCCGGCCAAGGG - Intergenic
921708898 1:218353610-218353632 GGGCCACCACACCAGGCAGAAGG - Intronic
921786037 1:219230393-219230415 GAGCCACCGCACCCGGCCGTAGG + Intergenic
921819127 1:219596535-219596557 GAGCCACCGCGCCCAGCTGGAGG - Intergenic
921833103 1:219750267-219750289 GAGCCACCGCGCCCGGCCTATGG + Intronic
922476512 1:225910520-225910542 GTGGCCCCACACCCAGCTGAGGG + Intronic
922510008 1:226157521-226157543 GTGCCACCACACCTGGCCTATGG + Intronic
922513492 1:226188497-226188519 GAGCCACCGCGCCTGGCCGAGGG + Intergenic
922655707 1:227381542-227381564 GAGCCACCGCACCTGGCCTATGG + Intergenic
922908311 1:229193736-229193758 GAGCCACTGCGCCCGGCCGATGG + Intergenic
922923634 1:229329704-229329726 GAGCCACCGTACCTGGCTGGAGG - Intronic
923011622 1:230092626-230092648 GAGCCACCGCACCTGGCCAAGGG + Intronic
923133067 1:231094122-231094144 ATGCCACTGCACCCAGCTCAAGG - Intergenic
923263257 1:232287683-232287705 GAGCCACCGCGCCCGGCCGAAGG + Intergenic
923466325 1:234250368-234250390 GAGCCACCGCGCCCGGCCCAAGG - Intronic
923649652 1:235862509-235862531 GAGCCACCGCACCCGGCCTTGGG - Intronic
923674675 1:236069535-236069557 GAGCCACCGCCCCCGGCCAAGGG - Intergenic
923768542 1:236915935-236915957 GAGCCACCGCACCCGGCGTGGGG - Intergenic
923887682 1:238177240-238177262 GAGCCACTGCACCCGGCTGTTGG + Intergenic
923904245 1:238365083-238365105 GAGCCACCGCACCCGGTTATCGG - Intergenic
923999228 1:239532293-239532315 GAGCCACCGCGCCCGGCTGGTGG + Intronic
924030505 1:239880997-239881019 GAGCCACCGCGCCCGGCCCAGGG - Intronic
924148251 1:241100089-241100111 GAGCCACCGCGCCCGGCCAATGG - Intronic
924183636 1:241464451-241464473 GAGCCACTGCACCCGGCTAAGGG - Intergenic
924329939 1:242931404-242931426 GAGCCACCGCGCCCGGCCAAAGG + Intergenic
924485307 1:244477278-244477300 GAGCCACTGCACCCGGCCAATGG + Intronic
924725728 1:246668886-246668908 GAGCCACCGCACTCGGCCCACGG + Intergenic
924760233 1:246977534-246977556 GAGCCACCACACCCGGCAAAAGG + Intronic
924762819 1:247005405-247005427 GAGCCACCACACCCGGCCAAGGG - Intronic
924764752 1:247021827-247021849 GAGCCACCACACCCGGCCGGAGG + Intergenic
924814517 1:247430158-247430180 GAGCCACCGCACCCGGCCGGTGG + Intronic
1062852702 10:757848-757870 GAGCCACCGCACCCAGCCGGCGG - Intergenic
1062870729 10:901197-901219 GAGCCACCGCACCCAGCAGAAGG + Intronic
1062871364 10:907919-907941 GAGCCACCGCACCCAGCCTAGGG - Intronic
1063037121 10:2297278-2297300 GAGCCACTGCACCCGGCCTATGG + Intergenic
1063470096 10:6277503-6277525 GAGCCACCACACCCGGCCGTGGG + Intergenic
1063781733 10:9332537-9332559 GAGCCACCGCGCCCGGCCGCAGG + Intergenic
1064076375 10:12272065-12272087 GAGCCACCGCGCCCGGCCCAAGG + Intergenic
1064095723 10:12423227-12423249 GAGCCACTGCACCTGGCCGAAGG - Intronic
1064226203 10:13487668-13487690 GAGCCACCGCACCTGGCCAATGG + Intronic
1064372137 10:14761881-14761903 CCGCCACCGCACCGGGCCGATGG + Intronic
1064389918 10:14933350-14933372 AAGCCACAGCACCTGGCTGAGGG - Intronic
1064418719 10:15171883-15171905 GAGCCACCGCGCCCGGCCTAAGG - Intergenic
1064424664 10:15219862-15219884 GAGCCACCGCGCCCGGCTAAGGG + Intronic
1064445427 10:15388669-15388691 GAGCCACCGCACCCGGCCTATGG + Intergenic
1064568318 10:16666701-16666723 GTGCCACCGCACCCGGCTGATGG - Intronic
1064705940 10:18072765-18072787 GAGCCACCGCACCCAGCCTATGG - Intergenic
1064770470 10:18717528-18717550 GAGCCACTGTACCTGGCTGAGGG + Intergenic
1065221350 10:23499271-23499293 GAGCCACCGCACCCGGCCAAGGG + Intergenic
1065268707 10:24004259-24004281 GAACCACAGCACCCGGCCGAGGG + Intronic
1065302464 10:24335440-24335462 GTACCACCACACCCGGCTAATGG + Intronic
1065311858 10:24423818-24423840 GAGCCACAGCACCCGGCCAAGGG + Intronic
1065476590 10:26144889-26144911 GGGCCACTGCACCTGGCTGAGGG - Intronic
1065584523 10:27204841-27204863 GAGCCACCGCGCCCGGCCCATGG - Intronic
1065648388 10:27861274-27861296 GAGCCACTGCACCCAGCTGAAGG + Intronic
1065720710 10:28626382-28626404 GAGCCACCGCGCCCAGCCGAGGG + Intergenic
1065727851 10:28683706-28683728 GAGCCACCGCGCCCGGCCTACGG - Intergenic
1065812166 10:29452188-29452210 ATGCCACCACACCTGGCTAATGG + Intergenic
1065890049 10:30113264-30113286 GAGCCACTGCACCCGGCTCTGGG - Intronic
1066111661 10:32202661-32202683 GAGCCACTGCACCCGGCCTAAGG + Intergenic
1066223198 10:33356094-33356116 GAGCCACTGCACCTGGCCGAGGG + Intergenic
1067136982 10:43618243-43618265 GAGCCACCGCGCCCGGCCGGGGG - Intergenic
1067447319 10:46359340-46359362 GAGCCACCGTACCCGGCCCATGG + Intergenic
1068796006 10:61081104-61081126 GAGCCACCACACCCGGCCGAAGG + Intergenic
1068865391 10:61889664-61889686 GAGCCACCGCGCCCGGCCGAGGG + Intergenic
1068886730 10:62105300-62105322 GAGCCATCGCGCCTGGCTGAAGG + Intergenic
1068989001 10:63132331-63132353 GAGCTACCGCACCTGGCTAAGGG - Intergenic
1069016339 10:63433378-63433400 GTGCCACCGCGCCCGGCCTAAGG + Intronic
1069402340 10:68062468-68062490 GAGCCACCGTGCCCGGCCGATGG - Intronic
1069475615 10:68729551-68729573 GAGCCACCGCGCCCGGCTCTTGG + Intronic
1069566599 10:69467462-69467484 ATGCCACCACACCTGGCTAAAGG - Intronic
1069787831 10:71000610-71000632 GAGCCACCGCGCCCGGCCTAAGG + Intergenic
1069922693 10:71826591-71826613 GAGCCACCACGCCCAGCTGAGGG - Intronic
1070076453 10:73141217-73141239 GAGCCACCGCACCCGGCCAACGG - Intronic
1070133775 10:73673950-73673972 GAGCCACCGTACCCGGCCCATGG - Intergenic
1070208519 10:74289329-74289351 GAGCCACCGTACCTGGCTGAAGG + Intronic
1071165276 10:82799241-82799263 GAGCCACCGCACCCAGCCTAGGG - Intronic
1071303693 10:84277974-84277996 GCGCCACCGCACTGGGCTAAAGG - Intergenic
1071673161 10:87630450-87630472 GAGCCACCGCGCCCAGCCGAGGG - Intergenic
1071846971 10:89530701-89530723 GAGCCACGGCGCCCGGCTGGTGG + Intronic
1071969396 10:90887667-90887689 GAGCCACCACACCCGGCCTAGGG + Intronic
1072038181 10:91583358-91583380 GAGCCACCGCGCCCGGCTTGAGG - Intergenic
1072313675 10:94181286-94181308 GAGCCACCGCACCCGGCCCATGG - Intronic
1072371978 10:94773063-94773085 GAGCCACCGCACCCGGCCATTGG + Intronic
1072589928 10:96819877-96819899 GAGCCACCGCGCCCGGCTGAAGG - Intergenic
1072650070 10:97288295-97288317 GAGCCACCACTCCCGGCTGCAGG - Intronic
1072703833 10:97665556-97665578 GAGCCACTGCGCCTGGCTGAGGG + Intronic
1073104678 10:101025829-101025851 GAGCCACCACACCCGGCCAATGG + Intronic
1073200287 10:101729850-101729872 GAGCCACCACGCCCGGCTGATGG - Intergenic
1073269967 10:102254247-102254269 GTGCCACAGCACCTGGCTACAGG - Intronic
1073398530 10:103238327-103238349 GAGCCACCGCACCCGGCTGCAGG - Intergenic
1073406828 10:103305761-103305783 GAGCCACTGCATCCAGCTGAGGG - Intronic
1073481459 10:103788580-103788602 GAGCCACCGCACCCGGCCTCAGG - Intronic
1073648725 10:105336099-105336121 GAGCCACCGCGCCCGGCCGGTGG - Intergenic
1073663875 10:105508394-105508416 GAGCCACCACACCTGGCTAATGG + Intergenic
1073809214 10:107134352-107134374 GAGCCACCGCGCCTGGCCGATGG - Intronic
1073843628 10:107527087-107527109 GAGCCACTGCACCCAGCTGATGG + Intergenic
1073899886 10:108207750-108207772 GAGTCACCGCACCTGGCTGATGG - Intergenic
1074127595 10:110541940-110541962 GAGCCACCACACCCGGCCCAGGG - Intergenic
1074134730 10:110616556-110616578 GAGCCACCGCGCCCGGCTCTGGG + Intergenic
1074591417 10:114817347-114817369 GAGCCACCGCGCCCGGCTGGAGG - Intergenic
1074787540 10:116854273-116854295 GAGCCACCGCGCCCGGCACATGG - Intronic
1075239798 10:120768003-120768025 GAGCCACCGCGCCCGGCCTATGG + Intergenic
1075340412 10:121643306-121643328 GAGCCACCACACCTGGCTCAGGG + Intergenic
1075378105 10:121996034-121996056 GAGCCACTGCACCTGGCTGCCGG + Intronic
1075546564 10:123359403-123359425 GAGCCACCGCACCTGGCCTAGGG - Intergenic
1075875290 10:125800852-125800874 GAGCCACTGCGCCCAGCTGAGGG + Intronic
1076109291 10:127848823-127848845 GAGCCACCGCGCCCGGCCCAGGG - Intergenic
1077067411 11:648477-648499 GAGCCACCGTGCCCAGCTGAAGG + Intronic
1077120620 11:906217-906239 GAGCCACTGCGCCCGGCTGTGGG + Intronic
1077146391 11:1048143-1048165 GAGCCACCGCGCCCGGCTCTGGG - Intergenic
1077255996 11:1583531-1583553 GAGCCACCGCACCTGGCCGCCGG + Intergenic
1077613018 11:3656216-3656238 GAGCCACCGCGCCCGGCCCAGGG + Intronic
1077619156 11:3703970-3703992 GAGCCACTGTGCCCGGCTGAAGG + Intronic
1077627382 11:3784850-3784872 GAGCCACCGCGCCCGGCCAAGGG - Intronic
1078202055 11:9192342-9192364 GAGCCACCGCGCCCGGCCGGGGG - Intronic
1078245354 11:9569563-9569585 GAGCCACTGCACCTGGCTGAAGG - Intergenic
1078790733 11:14539559-14539581 GAGCCACCGCACCCGGCCCGTGG - Intronic
1079615404 11:22486479-22486501 GAGCCGCTGCACCCGGCTTAAGG + Intergenic
1079842296 11:25418753-25418775 GAGCCACCGCACCCAGCTGAAGG - Intergenic
1080288366 11:30641937-30641959 GAGCCACCGCACCCGGCCAAGGG - Intergenic
1080327949 11:31099999-31100021 GAGCCACTGCACCCAGCTGATGG + Intronic
1080337374 11:31213432-31213454 AAGCCACCGCCCCCTGCTGAAGG - Intronic
1080467142 11:32508253-32508275 GAGCCACCGCGCCCAGCTCAGGG - Intergenic
1080788150 11:35494615-35494637 GAGCCACCGCACCCGGCCCAGGG + Intronic
1080825655 11:35846797-35846819 CTGCCAGCGCAACCGTCTGAGGG + Intergenic
1080887706 11:36381872-36381894 GAGCCACCGCGCCCGGCTGGTGG - Intronic
1081228487 11:40555003-40555025 GAGCCACCGCGCCCGGCCAATGG + Intronic
1081374835 11:42345252-42345274 GAGCCACCGCACCTGGCCAAGGG + Intergenic
1081843819 11:46223948-46223970 GAGCCACTGCGCCCGGCTTAAGG - Intergenic
1081858390 11:46317931-46317953 GAGCCACCGCGCCCGGCCCAGGG - Intronic
1081893335 11:46563553-46563575 GAGCCACTGCACCTGGCTGATGG - Intronic
1081915395 11:46727304-46727326 GAGCCACCACACCCGGCCCATGG + Intronic
1081939001 11:46924799-46924821 GAGCCACCGCACCTGGCCTAGGG - Intergenic
1081983073 11:47282117-47282139 GAGCCACCGCACCCAGCCCAGGG + Intronic
1082021687 11:47539365-47539387 GAGCCACCACACCCAGCTGTTGG - Intronic
1082027826 11:47585769-47585791 GAGCCACCGCGCCAGGCTGGTGG + Intergenic
1082035895 11:47645122-47645144 GAGCCACCGCGCCCGGCTTCTGG - Intergenic
1082070953 11:47939160-47939182 GAGCCACCACACCCGGCCTATGG - Intergenic
1082185648 11:49177661-49177683 GAGCCACCGCGCCCGGCTCCAGG - Intronic
1082917779 11:58457152-58457174 GAGCCACCGCACCCTGCCTAGGG - Intergenic
1083099798 11:60291513-60291535 GAGCCACCGCACCCAGCTGAAGG - Intronic
1083166098 11:60889042-60889064 GAGCCACCACACCCGGCCAAGGG + Intergenic
1083211700 11:61191886-61191908 GAGCCACCGCACCCGGCCTAGGG - Intergenic
1083228075 11:61297002-61297024 GAGCCACCGCACCCGGCTTGTGG + Intergenic
1083345529 11:61988171-61988193 GAGCCACCGCGCCTGGCTGAAGG - Intergenic
1083345535 11:61988199-61988221 GAGCCACTGCGCCTGGCTGAAGG - Intergenic
1083361343 11:62110878-62110900 GAGCCACCGCGCCCGGCAAAAGG + Intergenic
1083950272 11:65950844-65950866 GAGCCACCACACCTGGCTGCTGG + Intronic
1083975341 11:66114918-66114940 GAGCCACCACACCTGGCTTATGG - Intronic
1084387053 11:68850126-68850148 GAGCCACCGCACCTGGCCAATGG + Intergenic
1084529782 11:69720089-69720111 GAGCCACCGCGCCCGGCCTAAGG - Intergenic
1084764606 11:71299996-71300018 GAGCCACCACGCCCGGCTGGAGG - Intergenic
1084917573 11:72440678-72440700 GAGCCACCGTGCCCGGCTGCAGG - Intergenic
1084928282 11:72532156-72532178 GAGCCACCGCACCTGGCCGTGGG + Intergenic
1085146347 11:74201257-74201279 GAGCCACCGCGCCCGGCTACAGG + Intronic
1085512834 11:77096936-77096958 GAGCCACCGCGCCTGGCTGTGGG - Intronic
1085545396 11:77313261-77313283 GAGCCACCACACCCGGCAGCTGG + Intergenic
1085565397 11:77508942-77508964 GAGCCACCGCGCCCGGCCCAGGG + Intergenic
1085574671 11:77591583-77591605 GAGCCACCGCGCCCGGCTGAAGG - Intronic
1085574865 11:77593349-77593371 GAGCCACCGCGCCCGGCCGATGG - Intronic
1085633230 11:78137161-78137183 GAGCCACCGCGTCCGGCCGATGG + Intronic
1086042350 11:82494821-82494843 GAGCCACCGCGCCCGGCCTAGGG + Intergenic
1086383561 11:86284825-86284847 GAACCACCGCACCCGGCCCAAGG - Intergenic
1086585866 11:88450241-88450263 GAGCCACCGCGCCCGGCCTATGG + Intergenic
1086680678 11:89667675-89667697 GAGCCACCGCGCCCGGCTCCAGG + Intergenic
1086865323 11:91972800-91972822 GTGGCACCTCACCAAGCTGAAGG - Intergenic
1087030756 11:93701884-93701906 GAGCCACTGCACCTGGCTGTAGG + Intronic
1087098157 11:94339583-94339605 GAGCCACCGCACCCGGCGAAAGG + Intergenic
1087356539 11:97100808-97100830 GAGCCACCACGCCTGGCTGAAGG + Intergenic
1087770688 11:102206559-102206581 GAGCCACCGCACCTGGCCAAAGG - Intronic
1088344926 11:108812695-108812717 GAGCCACCGCAGCCAGCTGATGG - Intronic
1088979520 11:114849264-114849286 GAGCCACCACACCCGGCTGGAGG + Intergenic
1088982198 11:114874082-114874104 GAGCCACCGCGCCCAGCTGGGGG - Intergenic
1089212948 11:116818924-116818946 GAGCCACCGCGCCCGGCCCAGGG + Intergenic
1089251020 11:117161791-117161813 GAGCCACCGCGCCTGGCTGAAGG + Intronic
1089278259 11:117354300-117354322 GAGCCACCACACACGGCTCAAGG + Intronic
1089325084 11:117651419-117651441 GAGCCACCGCACCCGGCCTAGGG - Intronic
1089439063 11:118499497-118499519 GAGACACCACACCTGGCTGAGGG - Intronic
1089541563 11:119192258-119192280 GAGCCACCGCACCCGGTTGAAGG + Intronic
1089743930 11:120603884-120603906 GAGCCACCGCACCCGGCCAGGGG - Intronic
1089778412 11:120855845-120855867 GAGCCACCGCGCCCGGCCTATGG + Intronic
1090040713 11:123288766-123288788 GAGCCACCGCACCCGGCCCTGGG + Intergenic
1090346500 11:126075892-126075914 GAGCCACCGCACCTGGCGGGTGG - Intergenic
1090611588 11:128475833-128475855 GAGCCACCGCACCCGGCCCGGGG + Intronic
1090741009 11:129660210-129660232 GAGCCACCGCGCCCGGCCGGCGG - Intergenic
1090797511 11:130147538-130147560 GAGCCACCGCGCCTGGCTGGGGG + Intergenic
1090966872 11:131606338-131606360 GAGCCACCACACCTGGCTGACGG + Intronic
1091127711 11:133116249-133116271 GAGCCACTGCACCCGGCCAAGGG + Intronic
1091427992 12:408069-408091 GAGCCACCGCACCCGGCCACAGG + Intronic
1091501709 12:1024094-1024116 GAGCCACCGTGCCCAGCTGATGG - Intronic
1091704532 12:2684907-2684929 GTGCCACCCCACACCTCTGAGGG - Intronic
1091713137 12:2756411-2756433 GAGCCACTGCGCCCGGCCGATGG + Intergenic
1092080337 12:5710875-5710897 GAGCCACCGCGCCCGGCCCAGGG - Intronic
1092127927 12:6088192-6088214 GAGCCACCGCGCCCGGCCAAAGG - Intronic
1092175817 12:6405790-6405812 GAGCCACCGCGCCCGGCCAAAGG + Intergenic
1092357838 12:7811215-7811237 GAGCCACTGCGCCCGGCCGAAGG + Intergenic
1092480525 12:8855175-8855197 GAGCCACTGCACCCGGCAGCAGG + Intronic
1092823355 12:12374273-12374295 GAGCCACCGCACCCGGCCAAGGG + Intronic
1092825368 12:12394039-12394061 GAGCCACCGCACCCGGCCGAGGG - Intronic
1093157139 12:15699869-15699891 GAGCCACCGCACCTGGCCTAAGG - Intronic
1093191911 12:16084830-16084852 GAGCCACCGCGCCCAGTTGAGGG - Intergenic
1093367711 12:18323934-18323956 GAGCCACCGCGCCCGGCCAATGG - Intronic
1093466981 12:19459513-19459535 GAGCCACCGCGCCCGGCCGGGGG + Intronic
1093639408 12:21509112-21509134 GAGCCACCGCACCTGGCCAAAGG - Intronic
1093932830 12:24971384-24971406 GAGCTACCACACCCAGCTGAAGG - Intergenic
1094056637 12:26275027-26275049 GAGCCCACGCACCAGGCTGAAGG + Intronic
1094152561 12:27301542-27301564 GAGCCACCGCACCCGGCCGCTGG + Intronic
1094333223 12:29319273-29319295 GAGCCACCGCGCCCGGCCAAGGG + Intronic
1094590792 12:31817924-31817946 GAGCCACTGCACCCGGCTAGAGG + Intergenic
1094622999 12:32098132-32098154 GAGCCACTGCGCCCGGCTAAAGG + Intergenic
1094627448 12:32137371-32137393 GAGCCACCGCACCTGGCCTAAGG + Intronic
1094697980 12:32840581-32840603 GAGCCACCGCACCCAGCCAAGGG + Intronic
1095462078 12:42454064-42454086 GAGCCACTGCACCTGGCTAAAGG + Intronic
1095779812 12:46047274-46047296 GAGCCACCACACCCAGCTGTTGG - Intergenic
1096006057 12:48173000-48173022 GAGCCACCGCACCCGGCCAATGG + Intronic
1096124946 12:49112363-49112385 GAGCCACCGCGCGCGGCTAATGG - Intergenic
1096180043 12:49545673-49545695 GAGCCACCACACCCGGCAGGTGG + Intronic
1096251445 12:50035554-50035576 GAGCCACCACACCCGGCCTATGG - Intergenic
1096283806 12:50280440-50280462 GAGCCACCGCGCCCGGCCCAGGG + Intronic
1096354708 12:50930560-50930582 GAGCAACCGCACCCAGCTTAAGG + Exonic
1096374019 12:51092694-51092716 GAGCCACCGCACCTGGCCCAAGG - Intergenic
1096663747 12:53148419-53148441 GAGCCACCACACCCGGCTGGAGG - Intergenic
1096698230 12:53364639-53364661 GAGCCACCGCGCCCGGCCGCCGG + Intergenic
1096705917 12:53422023-53422045 GAGCCACTGCGCCCGGCCGAAGG - Intergenic
1096830495 12:54310146-54310168 GAGCCACCGCACCCATCTTAGGG - Intronic
1097764707 12:63512279-63512301 GAGCCACCGCACCCGGCCAATGG + Intergenic
1097786700 12:63768041-63768063 GTGCAGCAGCACCCAGCTGAGGG + Intergenic
1097940428 12:65298286-65298308 GAGCCACCACACCCTGCTGATGG + Intronic
1098050747 12:66450014-66450036 GAGCCACCGCGCCCGGCTCTTGG - Intronic
1098363790 12:69681330-69681352 GAGCCACTGCACCCGGCAAAAGG - Intronic
1098555942 12:71819160-71819182 GAGCCACTGCACCCAGCTCATGG - Intergenic
1098735753 12:74101955-74101977 GAGCCACCGCGCCTGGCCGAGGG - Intergenic
1099354644 12:81618814-81618836 GAGCCACCGCGCCCGGCCCATGG + Intronic
1099405197 12:82251202-82251224 GAGCCACCGCGCCCGGCCGACGG - Intronic
1100075651 12:90779942-90779964 GAGCCACCGCACCCGGCCCAAGG - Intergenic
1100125271 12:91417130-91417152 GAGCCACCGCGCCCGGCCAAAGG - Intergenic
1100379143 12:94045469-94045491 GAGCCACTGCACCCGGCCAAGGG - Intergenic
1100433534 12:94551564-94551586 GAGCCACCGCACCCGGCCGAGGG - Intergenic
1101125133 12:101625799-101625821 GAGCCACCGCGCCTGGCAGAAGG - Intronic
1101515446 12:105430656-105430678 GAGCCACTGCACCTGGCAGATGG - Intergenic
1101535149 12:105609739-105609761 GAGCCACCGCGCCCGGCCAAAGG + Intergenic
1102048103 12:109842358-109842380 GAGCCACTGCACCCGGCCAATGG - Intergenic
1102070643 12:110016230-110016252 GAGCCACCTCACCCGGCTAGGGG + Intronic
1102074970 12:110052478-110052500 GAGCCACCACACCAGGCTGCAGG + Intronic
1102077056 12:110067925-110067947 GAGCCACCGCACCCGGCCTTTGG - Intronic
1102199258 12:111046154-111046176 GAGCCAGCGCACCTGGCTGCTGG - Intronic
1102247897 12:111366786-111366808 GAGCCACCGCACCCTGCCTAAGG - Intronic
1102272195 12:111547142-111547164 GAGCCACCACACTCGGCTGCTGG - Intronic
1102300170 12:111765983-111766005 GAGCCACCGCGCCCGGCGGTGGG - Intronic
1102354886 12:112224548-112224570 GAGCCACCGCGCCCGGCCCAAGG + Intronic
1102382983 12:112483476-112483498 GAGCCAGCGCACCCGGCCAAGGG + Intronic
1102402473 12:112641680-112641702 GAGCCACCGTGCCCAGCTGAAGG + Intronic
1102690479 12:114756612-114756634 GGGCCACCACACCCGGCTTTTGG + Intergenic
1102915282 12:116747904-116747926 GAGCCACCGTGCCCGGCCGAGGG - Intronic
1102973938 12:117192615-117192637 GAGCTACCGCATCCGGCTCAAGG - Intergenic
1103034204 12:117643154-117643176 GAGTCACCGTGCCCGGCTGATGG - Intronic
1103073509 12:117964000-117964022 GAGCCACTGCACCCGGCCCAAGG - Intronic
1103248481 12:119478887-119478909 GAGCCACGGCACCCGACCGAGGG + Intronic
1103305782 12:119962902-119962924 GAGCCACCGCACCCAGCTATGGG + Intergenic
1103387980 12:120548952-120548974 GAGCCACCGCGCCCGGCTGAGGG + Intronic
1103467542 12:121153826-121153848 GGGCCACCACACCAGGCTGCAGG - Intronic
1103488885 12:121301562-121301584 GAGCCACCGCGCCCGGCAGTGGG - Intergenic
1103645050 12:122385213-122385235 GAGACACCGCACACGGCCGATGG + Intronic
1103654189 12:122457263-122457285 GAGCCACCGCACCTGGCCCAGGG - Intergenic
1103677785 12:122670226-122670248 GAGCCACCGCGCCCGGCCCAAGG - Intergenic
1104462867 12:128969609-128969631 GTGCCTCCGCACCTTGGTGATGG - Intronic
1104525117 12:129513767-129513789 GAGCCACCGCGCCCGGCCAATGG + Intronic
1104604579 12:130178767-130178789 GAGCCACCGTGCCCGGCTGCTGG - Intergenic
1104700135 12:130896764-130896786 GTGCCACCGCACCTGGCCCCGGG + Intergenic
1104872252 12:132008230-132008252 GAGCCACCGCACCCGGCCTGAGG + Intronic
1105065689 12:133195418-133195440 GTGCCACTGCACCTGGCACATGG - Intronic
1105230163 13:18486939-18486961 GAGCCACCGCACCCAGCCAAAGG + Intergenic
1105552912 13:21414653-21414675 GAGCCACCGCGCCCGGCCTAGGG + Intronic
1105562608 13:21508406-21508428 GAGCCACCACACCCGGCCCAAGG + Intronic
1105901538 13:24758790-24758812 GAGCCACCGCGCCCAGCCGAAGG - Intergenic
1105926438 13:25012874-25012896 GTGCCACTGCACTCTGCTCAGGG + Intergenic
1105944339 13:25176785-25176807 GTGACCCCGAACCCTGCTGAAGG - Intergenic
1106260727 13:28064288-28064310 GAGCCATCGCCCCTGGCTGAGGG - Intronic
1106293028 13:28383377-28383399 GAGCCACCACACCCGGCTCTAGG - Intronic
1106296598 13:28419593-28419615 GAGCCACCGCACCCGGCCGCTGG - Intronic
1106441378 13:29775899-29775921 GAGCCACCACGCCCAGCTGACGG + Intronic
1106530043 13:30582352-30582374 GAGCCACCACGCCCGGCTGGTGG - Intronic
1106538279 13:30666951-30666973 GAGCCACCACACCCAGCCGAGGG + Intergenic
1106615820 13:31326563-31326585 GAGCCACCACACCTGGCTGTAGG + Intronic
1106704540 13:32266697-32266719 GTGCCACCGCACCTGGCAAGAGG - Intronic
1107259725 13:38476076-38476098 GAGCCACCGTGCCTGGCTGAGGG - Intergenic
1107416115 13:40202019-40202041 GAGCCACTGCACCCGGCCCAAGG + Intergenic
1107650794 13:42542541-42542563 GAGCCACTGCGCCCGGCTGAAGG + Intergenic
1107687259 13:42915245-42915267 GAGCCACCGCACCTGGCCAAAGG - Intronic
1107720447 13:43242849-43242871 GAGCCACTGCACCCGGCCTAAGG - Intronic
1107816090 13:44245863-44245885 GAGCCACCGCACCCGGTCCATGG - Intergenic
1107892633 13:44927655-44927677 GAGCCACCGCACCTGGCTGAAGG - Intergenic
1107935745 13:45343741-45343763 GAGCCACCGCGCCCGGCCAAAGG - Intergenic
1108035018 13:46281625-46281647 GAGCCACCGTGCCCGGCTGCAGG + Intergenic
1108045430 13:46379358-46379380 GAGCCACCGCAGGCGGCCGAGGG + Intronic
1108184834 13:47878315-47878337 GAACCATCGCACCTGGCTGAAGG - Intergenic
1108339481 13:49483902-49483924 GAGCCACCGCACCCAGCTGCTGG + Intronic
1108339562 13:49484552-49484574 GAGCCACTGCGCCTGGCTGAAGG + Intronic
1108380036 13:49846596-49846618 GAGCCACCGCGCCCGGCCCAGGG + Intergenic
1108537722 13:51403297-51403319 GAGCCACCACACCCAGCTAAGGG - Intronic
1108584040 13:51852593-51852615 GAGCCACCGCGCCCGGCCGCGGG - Intergenic
1108650750 13:52477249-52477271 GAGCCACCGCACCCGGCCACAGG + Intergenic
1109588515 13:64443362-64443384 GAGCCACCGCGCCCGGCCCAGGG - Intergenic
1109689749 13:65870150-65870172 GAGCCACCGCACCCGGCCTATGG + Intergenic
1109690749 13:65884897-65884919 GAGCCACCACACCTGGCCGAGGG + Intergenic
1110129723 13:71992285-71992307 GAGCCACCGCGCCCGGCTGAGGG - Intergenic
1110143295 13:72157953-72157975 GAGCCACCGCACCCGGCCTCAGG + Intergenic
1110626105 13:77658060-77658082 GTGCCACCGCACTCGGCCTTCGG - Intergenic
1110670640 13:78173104-78173126 GAGCCACCACACCCGGCCTATGG + Intergenic
1110749934 13:79101282-79101304 GAGCCACCGCGCCCGGCCGTGGG + Intergenic
1110759419 13:79214782-79214804 GTGCCACTACACCCGGGTGATGG + Intergenic
1110776983 13:79419074-79419096 GAGCCACCGCGCCCGGCCCAGGG + Intergenic
1111166495 13:84463939-84463961 GAGCCACCGCACCCGGCCTGTGG + Intergenic
1111249031 13:85579632-85579654 GAGCCACCGTGCCTGGCTGAAGG - Intergenic
1111976640 13:94973100-94973122 GAGCGACCGCACCTGGCTGCAGG + Intergenic
1112033741 13:95479064-95479086 GAGCCACTGCACCCGGCCGGTGG - Intronic
1112272725 13:97984260-97984282 GAGCCACCGCGCCCGGCCTAGGG + Intronic
1112897604 13:104319977-104319999 GAGCCACCGCGCCCGGCCCAGGG + Intergenic
1113083311 13:106540029-106540051 GAGCCACCGCGCCCGGCCAAAGG - Intergenic
1113187603 13:107707204-107707226 GAGCCACCGCGCCCGGCCAAGGG + Intronic
1113772879 13:112922546-112922568 GAGCCACTGCGCCTGGCTGATGG - Intronic
1113794372 13:113048724-113048746 GAGCCACCGCGCCCGGCTTATGG + Intronic
1114474484 14:22984087-22984109 GAGCCACCGCTCCCGGCCGTTGG - Intergenic
1114640315 14:24215366-24215388 GAGCCACCGCGCCCGCCTGCTGG + Intronic
1115182573 14:30646303-30646325 GAGCCACCACGCCCAGCTGAGGG + Intronic
1115213376 14:30990450-30990472 GAGCCACCGCGCCCGGCCAAAGG + Intronic
1115360343 14:32493493-32493515 GAGCTACCGCACCCGGCCTAAGG + Intronic
1115676157 14:35677056-35677078 GAGCCACCACACCCGGCCCAAGG - Intronic
1115742569 14:36403838-36403860 GTGCCAGCGCACCCGGCCTATGG - Intergenic
1115987954 14:39122003-39122025 GAACCACCGCACCCGGCCTAAGG + Intronic
1116148770 14:41110494-41110516 GAGCCACCGTGCCCGGCTCAGGG - Intergenic
1116712336 14:48383978-48384000 GAGCCACCGCGCCCGGCCAAAGG - Intergenic
1116816280 14:49586574-49586596 GCGCCACCGCGCCCGGCGGTCGG - Intronic
1116845672 14:49862833-49862855 GCGCCACCGCGCCCGGCGGTCGG + Intergenic
1117135092 14:52727311-52727333 GAGCCACCGCACCCGGCCTGTGG + Intronic
1117353066 14:54900147-54900169 GAGCCACCGCGCCCGGCCCATGG + Intronic
1117530149 14:56653007-56653029 GAGCCACCGCGCCCGGCCCATGG - Intronic
1117603263 14:57397640-57397662 GAGCCACCGCACCCGGCACCTGG - Intronic
1117647671 14:57868746-57868768 GAGCCACCGTGCCCGGCGGAAGG + Intronic
1117972486 14:61265808-61265830 GAGCCACTGCACCCAGCTGGGGG - Intronic
1118196168 14:63628677-63628699 GAGCCACCGCACCCGGCCAGTGG - Intronic
1118272969 14:64360645-64360667 GAGCCACCGCACCTGGCTGAAGG - Intergenic
1118293512 14:64547751-64547773 GAGCCACCGCGCCCGGCCAATGG - Intergenic
1118306723 14:64661237-64661259 GAGCCACAGCACCTGGCTGTAGG - Intergenic
1118319544 14:64745058-64745080 GAGCCACTGCATGCGGCTGAAGG + Exonic
1118373609 14:65158192-65158214 GAGCCATCGCGCCCGGCTGAAGG + Intergenic
1118438638 14:65793139-65793161 GAGCCACCGCGCCCGGCCAAGGG + Intergenic
1118797725 14:69158533-69158555 GAGCCACCGCGCCTGGCCGAGGG + Intergenic
1119038615 14:71252129-71252151 GAGCCACCGCACCCGGCCTCAGG - Intergenic
1119378905 14:74216369-74216391 GAGCCACTGCGCCCGGCTGACGG - Intergenic
1119378972 14:74216836-74216858 AAGCCACCGCACCCGGCCCAGGG - Intergenic
1119379094 14:74217568-74217590 GAGCCACCGCACCTGGCCCAAGG + Intergenic
1119524644 14:75312712-75312734 GAGCCACTGCACCCGGCCAATGG - Intergenic
1119737627 14:76993733-76993755 GAGCCACCGCGCCTGGCTGGGGG + Intergenic
1119795870 14:77396531-77396553 GAGCCACCGCACCCAGCCCAAGG + Intronic
1119923122 14:78465815-78465837 GAGCCACCGCGCCCGGCCTAAGG + Intronic
1119942555 14:78656757-78656779 AAGCCACCGCACTCGGCCGAGGG - Intronic
1120126647 14:80751913-80751935 GAGCCACCGCACCCAGGTAATGG + Intronic
1120211356 14:81637129-81637151 GAGCCACCGCGCCCGGCCTATGG - Intergenic
1120310180 14:82816662-82816684 AAGCCACCGCACCCGGCTGCTGG + Intergenic
1120391785 14:83918179-83918201 GAGCCACCACACCAGGCTGAAGG - Intergenic
1120430047 14:84402081-84402103 GAGCCACCGCACCTGGCCAAGGG - Intergenic
1120568921 14:86093657-86093679 GAGCCACCGCGCCCGGCCGAGGG - Intergenic
1120604598 14:86559051-86559073 GAGCCACCGCACCCAGCCGATGG - Intergenic
1120755426 14:88239572-88239594 GAGCCACCGCACCTGGCCTAGGG - Intronic
1121159991 14:91729053-91729075 GAGCCACCACACCTGGCCGATGG - Intronic
1121287327 14:92746750-92746772 GAGCCACCGCGCCCGGCTGGTGG - Intronic
1121459687 14:94065334-94065356 GAGCCACTGCACCCGGCGTATGG + Intronic
1121650715 14:95555846-95555868 GAGCCACCGCGCCCGGCCCAGGG + Intergenic
1121667094 14:95680847-95680869 GAGCCACCGCGCCCGGCCTAGGG - Intergenic
1122116407 14:99529686-99529708 GAGCCACTGCGCCCAGCTGAGGG + Intronic
1122135123 14:99628293-99628315 GAGCCACCGCCCCCGGCTGTTGG - Intergenic
1122147182 14:99698451-99698473 GAGCCACCACACCTGGCTGCGGG - Intronic
1122293127 14:100690154-100690176 GAGCCACCGCGCCCGGCCGAGGG + Intergenic
1122338044 14:101006747-101006769 GAGCCACCGCGCCCAGCTCAGGG - Intergenic
1122434510 14:101685317-101685339 GAGCCACCGCGCCCAGCCGACGG + Intergenic
1122462892 14:101910546-101910568 GAGCCACCGCACCCGGCCCAGGG - Intronic
1122551535 14:102552755-102552777 GAGCCACCGCGCCCGGCCTATGG + Intergenic
1122565257 14:102649913-102649935 GAGCCACCGCGCCCGGCCCAAGG - Intronic
1122576870 14:102748411-102748433 GAGCCACCGCTCCCGGCACAGGG + Intergenic
1122603842 14:102934725-102934747 GAGCCACCGCACCCGGCCCGTGG - Intronic
1122725203 14:103746088-103746110 GAGCCACTGCACCCGGCCCATGG + Intronic
1122729092 14:103781934-103781956 GAGCCACCGCGCCCGGCCAAAGG + Intronic
1122745687 14:103896044-103896066 CAGCCACCGCACCCGGCCCAGGG + Intergenic
1122747034 14:103903952-103903974 GAGCCACCGCACCCGGCCGCAGG - Intergenic
1123700461 15:22911055-22911077 GTGCCACCACACCAGGCTAATGG - Intronic
1123898326 15:24850597-24850619 GAGCCACTGCACCCGGCCTAAGG + Intronic
1123986108 15:25647633-25647655 GTGCCACTGCACTCCGGTGAGGG + Intergenic
1124047306 15:26162178-26162200 GAGCCACTGCGCCCGGCTGCTGG - Intergenic
1124350285 15:28950342-28950364 GAGCCACCGCACCCCGCTGAAGG - Intronic
1124470155 15:29977066-29977088 GAGCCACCGCACCCGGCCCCTGG + Intergenic
1124640973 15:31396439-31396461 GAGCCACCGCGCCCGGCCTAGGG + Intronic
1124941619 15:34223925-34223947 GGGCCACTGCACCCAGCAGATGG - Intergenic
1125100639 15:35908294-35908316 GTGCCACTGCACCTGGCCTAAGG + Intergenic
1125297824 15:38221879-38221901 GAGCCACCGCGCCCGGCCGGAGG + Intergenic
1125349161 15:38749786-38749808 GAGCCACCGCGCCCGGCCCAGGG - Intergenic
1125698280 15:41657638-41657660 GAGCCACCGCACCTGGCCGAAGG + Intronic
1126609971 15:50519428-50519450 GAGCCACCGCACCCGGCCTCAGG - Intronic
1126698862 15:51350025-51350047 GAGCCACCGCACCCGGCCTAGGG + Intronic
1126765912 15:52010801-52010823 GAGCCACCGCGCCTGGCGGAGGG + Intronic
1126809045 15:52382184-52382206 GAGCCACTGCACCCGGCTGACGG + Intronic
1127283855 15:57515872-57515894 GAGCCACCACACCCGGCCCAGGG - Intronic
1127464779 15:59233379-59233401 GAGCCACCGCGCCCGGCCGATGG - Intronic
1127485663 15:59415400-59415422 GAGCCACCGCACCCAGCAAAAGG + Intronic
1127522406 15:59755666-59755688 GAGCCACCGCGCCCGGCCGGGGG + Intergenic
1127585215 15:60371865-60371887 GAGCCACCGCGCCCGGCAAAAGG - Intronic
1127618141 15:60707645-60707667 GAGCCACCGCACCTGGCCCACGG + Intronic
1128051927 15:64672294-64672316 GAGCCACCGCACCCAGCCCAAGG + Intronic
1128105344 15:65040286-65040308 GAGCCACCGCACCTGGCCTATGG - Intergenic
1128204325 15:65837369-65837391 GAGCCACCACACCCGGCTAAGGG + Intronic
1128279261 15:66381149-66381171 GAGCCACCGTGCCCGGCCGAAGG - Intronic
1128368061 15:67018740-67018762 GAGCCACCGTGCCCGGCTAAAGG - Intergenic
1128398194 15:67250740-67250762 GAGCCACCGCACCCGGCGACAGG - Intronic
1128883013 15:71260814-71260836 GAGCCACCGCACCTGGCCTAGGG - Intronic
1129024129 15:72553057-72553079 GAGCCACCGCACCCGGCCTAGGG + Intronic
1129275162 15:74440619-74440641 GAGCCACCGCGCCCGGCCAAGGG - Intergenic
1129281982 15:74492551-74492573 GAGCCACCGCACCCAGCCCATGG + Intergenic
1129352649 15:74965764-74965786 GAGCCACCGCGCCCGGCGCAGGG - Intronic
1129446639 15:75623727-75623749 GAGCCACTGCACCCGGCTTGAGG + Intronic
1129792984 15:78354019-78354041 GAGCCACTGCACCCGGCCTATGG - Intergenic
1129807360 15:78474769-78474791 GAGCCACCGCGCCCGGCCTATGG - Intronic
1129807835 15:78479242-78479264 GAGCCACTGGACCTGGCTGAGGG + Intronic
1129807936 15:78480393-78480415 GAGCCACCGCACCTGGCCAAGGG - Intronic
1130372867 15:83301535-83301557 GAGCAACCGTACCCGGCTGATGG + Intergenic
1130421427 15:83750832-83750854 GAGCCACTGCGCCCGGCTGGGGG + Intronic
1130683458 15:86016607-86016629 GAGCCACTGCACCCGGCCGAAGG - Intergenic
1130915147 15:88299234-88299256 GAGCCACCGCACCTGGCCAAAGG + Intergenic
1130936515 15:88475521-88475543 GTGCCACCAGACCTGGCTAACGG - Intronic
1131167102 15:90150156-90150178 GAGCCACCGCGCCCGGCTGTCGG - Intergenic
1131193325 15:90334839-90334861 GAGCCACCGCACCCGGCGTCAGG + Intergenic
1131264842 15:90909885-90909907 GAGCCACCGCGCCCAGCCGAAGG + Intronic
1131398392 15:92104951-92104973 CAGCCACCGCGCCCGGCTGGAGG - Intronic
1131568105 15:93504916-93504938 GAGCCACCGCGCCCGGCCAAGGG + Intergenic
1131617232 15:94029165-94029187 GAGCCACCACGCCCGGCCGAAGG - Intergenic
1131648401 15:94371836-94371858 CTGCCACCACACCTGGCTAAGGG + Intronic
1131795376 15:96010848-96010870 GAGCCACCGCGCCCGGCCGAGGG + Intergenic
1132052454 15:98618283-98618305 GAGCCACCGCGCCCGGCCGGTGG + Intergenic
1132273050 15:100543812-100543834 GTGCCACCGCACGTGGCTGTGGG + Intronic
1132352237 15:101147081-101147103 GAGCCACCGTGCCCGGCTGAAGG + Intergenic
1132596595 16:753854-753876 GAGCCACCGTGCCCGGCTAAAGG - Intronic
1132669023 16:1095179-1095201 GGGCCCCCACACCCGGCAGATGG + Intronic
1132741539 16:1415673-1415695 GAGCCACCGCGCCCGGCCAATGG - Intergenic
1132824046 16:1894134-1894156 GAGCCACCACACCTGGCTAATGG - Intergenic
1132903219 16:2269422-2269444 GAGCCACCGCCCCCGGCCGAGGG + Intergenic
1132979172 16:2726693-2726715 GAGCCACCGCACCTGGCCGGTGG + Intergenic
1133000894 16:2850921-2850943 GAGCCACCGCACCTGGCCTAGGG - Intergenic
1133067360 16:3218268-3218290 GAGCCACCGTGCACGGCTGAAGG + Intergenic
1133074917 16:3272572-3272594 AAGCCACCACACCCGGCTGAGGG + Intronic
1133134554 16:3700748-3700770 GAGCCACCGCACCTGGCCAAGGG + Intronic
1133312848 16:4861655-4861677 GAGCCACTGCACCCTGCCGATGG - Intronic
1133409368 16:5555735-5555757 GAGCCACTGCACCCAGCCGAGGG - Intergenic
1133552135 16:6866824-6866846 GAGCCACCGCGCCCAGCTAAAGG + Intronic
1133742411 16:8661360-8661382 GAGCCACCGCGCCCGGCCAACGG - Intergenic
1134080365 16:11320667-11320689 GAGCCACCGCACCTGGCCCAGGG - Intronic
1134264998 16:12685164-12685186 GAGCCGCCGCACCTGGCTGAGGG - Intronic
1134280490 16:12812634-12812656 GAGCCACCGCACCTGGCCTAGGG + Intergenic
1134287350 16:12873637-12873659 GAGCCACCGCACCCGGCCAAAGG + Intergenic
1134318030 16:13137736-13137758 GAGCCACCGCACCTGGCTGGAGG + Intronic
1134326156 16:13209815-13209837 GAGCCACTGCACCCGGCCTAGGG - Intronic
1134445788 16:14330439-14330461 GAGCCACCGCGCCCAGCTAAAGG - Intergenic
1134528318 16:14962012-14962034 GAGCCACCGCACCTGGCTGGGGG + Intergenic
1134739495 16:16529917-16529939 GAGCCACCGCACCTGGCTGAGGG + Intergenic
1134928005 16:18182234-18182256 GAGCCACCGCACCTGGCTGAGGG - Intergenic
1135008327 16:18848786-18848808 GAGCCACCGTGCCCGGCTGTAGG - Intronic
1135019926 16:18954959-18954981 GAGCCACCACACCTGGCTGAGGG - Intergenic
1135028022 16:19013801-19013823 GAGCCACTGCGCCCGGCCGAGGG + Intronic
1135055998 16:19232544-19232566 GAGCCACCGCACCGGGCCAAGGG - Intronic
1135538908 16:23315050-23315072 GAGCCACCGCACCCAGCCGGTGG - Intronic
1135589370 16:23694279-23694301 GAGCCACCGCACCCGGCAATGGG + Intronic
1135688158 16:24514930-24514952 GGGCCACCGCGCCCGGCCAAGGG + Intergenic
1135823425 16:25705002-25705024 GAGCCACCGCACCCGGCCCTGGG + Intronic
1135913389 16:26581363-26581385 GAGCCACCGCACCCGGCCTCAGG + Intergenic
1136038086 16:27555853-27555875 GAGCCACCGCGCCTGGCTGTAGG - Intronic
1136363999 16:29800168-29800190 GAGCCACCGCATCCGGCCTAGGG - Intronic
1136400864 16:30017670-30017692 GAGCCACCGCACCCGGCAATAGG - Intronic
1136466613 16:30448547-30448569 GAGCCACTGCACCTGGCTGAGGG + Intergenic
1136528053 16:30845820-30845842 GAGCCACTGCGCCCAGCTGAAGG - Intronic
1136570954 16:31096355-31096377 GAGCCACCGCACCCGGCCAATGG + Intergenic
1136632594 16:31497619-31497641 GAGCCACCGCCCCTGGCTGAGGG + Intronic
1136860972 16:33702689-33702711 GAGCCACTGCACCCGGCCAATGG + Intergenic
1137398588 16:48134766-48134788 GAGCCACCACTCCTGGCTGAGGG - Intronic
1137440668 16:48496618-48496640 GTGCTCCCGAAGCCGGCTGAGGG + Intergenic
1137541863 16:49368631-49368653 GAGCCACCGCACCTGGCAGGTGG - Intergenic
1137645963 16:50074622-50074644 GAGCCACCGCACCCGGCCTGAGG + Intronic
1137648004 16:50092724-50092746 GAGCCACCGCGCCCGGCCCAAGG + Intronic
1137899999 16:52257175-52257197 GAGCCACCACACCCGGCCTAGGG - Intergenic
1137937103 16:52645305-52645327 GTGCCACCTGAACTGGCTGAAGG + Intergenic
1138093580 16:54195143-54195165 GAGCCACCGCGCCCGGCCGATGG - Intergenic
1138155891 16:54702510-54702532 GAGCCACCGCGCCCGGCCAATGG - Intergenic
1138571407 16:57875936-57875958 GTGCCACCATGCCTGGCTGAGGG - Intergenic
1138684536 16:58713352-58713374 GAGCCACCGCACCCAGCTCAGGG - Intronic
1139000672 16:62506325-62506347 GAGCCACCGCGCCCGGCCCAGGG - Intergenic
1139033702 16:62917144-62917166 GAGCCACCGTACCCGGCCAAGGG + Intergenic
1139048870 16:63098625-63098647 GAGCCACCACACCCAGCCGAGGG - Intergenic
1139351647 16:66340153-66340175 GAGCCACCGCACCCAGCCTATGG + Intergenic
1139406910 16:66726507-66726529 GAGCCACCACCCCTGGCTGAGGG - Intronic
1139537208 16:67584085-67584107 GAGCCACTGCGCCCAGCTGAAGG - Intronic
1139738668 16:69015762-69015784 GAGCCACCGCACCTGGCCAATGG + Intronic
1139758432 16:69164166-69164188 GAGCCACCGCGCCCGGCTGATGG + Intronic
1139845758 16:69920077-69920099 GAGTCACCACACCCAGCTGATGG + Intronic
1139963690 16:70732931-70732953 GAGCCACCACACCCGGCCCAAGG + Intronic
1139974075 16:70795180-70795202 GAGCCACTGCGCCCGGCTCAGGG - Intronic
1140019523 16:71224843-71224865 GAGCCACCGCGCCCGGCCTAAGG + Intronic
1140062820 16:71586323-71586345 GAGCCACCGCGCCTGGCTGTAGG - Intergenic
1140088430 16:71817229-71817251 GAGCCACCGCGCCCGGCCTAGGG - Intergenic
1140114196 16:72027413-72027435 GAGCCACCGCACCCGGCCCAAGG + Intronic
1140441096 16:74988483-74988505 GAGCCACCGCACCTGGCCTACGG - Intronic
1140617957 16:76690142-76690164 GAGCCACCGCACCTGGCTTATGG + Intergenic
1140719396 16:77757664-77757686 GAGCCACCGCGCCCAGCTGGAGG - Intergenic
1141063425 16:80895760-80895782 GCGCCACCGCACCCAGCCGTGGG - Intergenic
1141106744 16:81240419-81240441 GAGCCACCGCACCTGGCCGTGGG - Intronic
1141462529 16:84186267-84186289 GAGCCACCGCACCCGGCCAAAGG - Intronic
1141526648 16:84616214-84616236 GAGCCACTGCGCCCGGCCGACGG - Intronic
1141560781 16:84866518-84866540 GAGCCACCGCACCCGGCCTGAGG + Intronic
1141577313 16:84972455-84972477 GTGCCACTGCACCTGGCCCACGG - Intergenic
1141656239 16:85418119-85418141 GAGCCACCGCGCCTGGCTGGAGG + Intergenic
1141719007 16:85744855-85744877 AAACCACTGCACCCGGCTGACGG - Intronic
1141729384 16:85811465-85811487 GAGCCACTGCACCCAGCTGAGGG + Intergenic
1141774963 16:86117081-86117103 GTGCCACTGCACCTGGCTTCTGG + Intergenic
1141867480 16:86760766-86760788 GAGCCACCGCGCCCGGCCAATGG + Intergenic
1141952805 16:87349758-87349780 ATGCCACCACACCGGGCTGATGG - Intronic
1142175167 16:88641941-88641963 GAGCCACCGCGCCCGGCCAAGGG + Intergenic
1142362102 16:89632335-89632357 GAGCCACCGCGCCCGGCCGGGGG + Intronic
1142396802 16:89836693-89836715 GAGCCACCGCCCCCGGCCGGGGG - Intronic
1142407926 16:89901459-89901481 GAGCCACCGCGCCCGGCCGGAGG - Intronic
1142408026 16:89901931-89901953 GAGCCACCGCGCCCGGCCGGAGG - Intronic
1142408126 16:89902403-89902425 GAGCCACCGCGCCCGGCCGGAGG - Intronic
1203122466 16_KI270728v1_random:1550879-1550901 GAGCCACTGCACCCGGCCAATGG + Intergenic
1142562437 17:818599-818621 GAGCCACTGCACCCGGCCCATGG - Intronic
1142581589 17:946449-946471 GAGCCACCACACCCGGCCAAAGG + Intronic
1142613222 17:1120561-1120583 GAGCCACCGCACCCGGCCAATGG + Intronic
1142633369 17:1240732-1240754 GAGCCACCGCGCCCGGCCAATGG - Intergenic
1142690432 17:1603041-1603063 GAGCCACTGCGCCCGGCCGAGGG + Intronic
1142824309 17:2498451-2498473 GAGCCACCGCGCCCAGCTGATGG - Intronic
1142883448 17:2898194-2898216 GAGCCACCTCACCCGGCCAACGG + Intronic
1143026139 17:3943001-3943023 GAGCCACCGCTCCTGGCTGACGG - Intronic
1143069434 17:4278182-4278204 GCGCCACCGCGCCCGGCCTAAGG + Intronic
1143145124 17:4770278-4770300 GTGCCACCACACCTGGCTAATGG - Intergenic
1143145824 17:4774621-4774643 GAGCCACTGCGCCCGGCCGATGG - Intronic
1143162461 17:4880569-4880591 GAGCCACAGCGCCCGGCTGAGGG + Intronic
1143230496 17:5350094-5350116 GAGCCACCGCGCCCGGCCAATGG - Intronic
1143338461 17:6191044-6191066 GAGCCACCGTGCCCGGCCGATGG - Intergenic
1143641490 17:8200835-8200857 GAGCCACCGCACCCGGCCAAAGG - Intergenic
1143702478 17:8671566-8671588 GAGCCACCGCACCCGGCCTTTGG - Intergenic
1143908525 17:10228589-10228611 GAGCCACCGTGCCCGGCCGAAGG + Intergenic
1143913889 17:10274882-10274904 GGGCCACCGCGCCCGGCCTAGGG + Intergenic
1143951541 17:10636629-10636651 GAGCCACCGCACCCGGCCTATGG - Intronic
1144241540 17:13317470-13317492 GAGCCACCGCGCCCGGCCAAGGG + Intergenic
1144301026 17:13923174-13923196 GTGGCACCCCACAGGGCTGAAGG + Intergenic
1144376367 17:14646113-14646135 GAGCCACCGCGCCCGGCCCAGGG + Intergenic
1144700114 17:17332062-17332084 GAGCCACCGCATCCGGCCTATGG + Intronic
1145163783 17:20594744-20594766 GAGCCACCGTGCCCGGCCGAAGG + Intergenic
1145225359 17:21123800-21123822 GAGCCACCGCGCCCGGCCGAGGG - Intronic
1145226986 17:21137739-21137761 GAGCCACCGCACCCGGCCTCTGG + Intronic
1145736442 17:27235493-27235515 GAGCCACCGCACCAGGCCTATGG - Intergenic
1145860773 17:28208162-28208184 GAGCCACCGCGCCCGGCCGAGGG - Intergenic
1145873983 17:28301721-28301743 GAGCCACCACACCCGGCCCATGG + Intergenic
1145932500 17:28696020-28696042 GAGCCACCGCACCTGGCTCCTGG - Intronic
1145947867 17:28791594-28791616 GAGCCACTGCACCTGGCTTAGGG - Intronic
1145982974 17:29025013-29025035 GAGCCACCGCACCCGGCCAGGGG - Intronic
1146023257 17:29297187-29297209 GTGCCACCACGCCCGGCTAAGGG - Intergenic
1146036281 17:29409615-29409637 GAGCCACCGCACCCAGCCTATGG + Intronic
1146050819 17:29552069-29552091 GAGCCACCGCACCCGGACGAGGG - Intergenic
1146113775 17:30116010-30116032 GAGCCACCGCGCCCGGCCCAAGG - Intronic
1146177965 17:30678944-30678966 CCGCCACCACACCCGGCTAATGG - Intergenic
1146270266 17:31480503-31480525 GAGCCACCGCACCCGGCCAGGGG - Intronic
1146286850 17:31579887-31579909 GTGCCACCGCGCCTGGCTGGTGG + Intergenic
1146369210 17:32254429-32254451 GAGCCACCGCACCCGGCCGTTGG + Intergenic
1146438385 17:32872556-32872578 GAGCCACCGCGCCCGGCCGCAGG + Intronic
1146448303 17:32951172-32951194 GAGCCACTGCACCCGGCCCATGG - Intergenic
1146510478 17:33443698-33443720 GAGCCACCGCGCCCGGCCGGAGG + Intronic
1146767727 17:35539040-35539062 GAGCCACCGCGCCCGGCAAAAGG - Intergenic
1146829863 17:36059093-36059115 GAGCCACCGCGCCCGGCTGAAGG - Intergenic
1147018985 17:37515742-37515764 GAGCCACCACGCCCGGCTAAAGG + Exonic
1147122137 17:38341831-38341853 GAGCCACCACACCCAGCGGAAGG - Intronic
1147381187 17:40057184-40057206 GAGCCACCGCGCCCGGTTGGGGG - Intronic
1147385994 17:40082644-40082666 GAGCCACCGCGCCCGGCCAAGGG + Intronic
1147411653 17:40257259-40257281 GAGCCACCGCGCCCGGCTTGAGG + Intronic
1147423419 17:40333919-40333941 GTACCACTGCACCCAGCTCAGGG + Intronic
1147431063 17:40371122-40371144 GTGCCACCACGCCCGGCTATTGG - Intergenic
1147523259 17:41195238-41195260 GAGCCACCACGCCCGGCTGCAGG - Intronic
1147614690 17:41821056-41821078 GTGCCCCCGCACCTGGCCCACGG + Exonic
1147643844 17:42021923-42021945 GATCCACCGCACCCGGCCAATGG - Intronic
1147981079 17:44274459-44274481 GTGCCACTGCACCCGGCAAAGGG - Intergenic
1148058918 17:44821411-44821433 GAGCCACCGCACCCAGCCGATGG - Intronic
1148121358 17:45214040-45214062 GAGCCACCGCACCTGGCTTATGG + Intergenic
1148289208 17:46428641-46428663 GAGCCACCGCACCCGGCCTAAGG - Intergenic
1148311377 17:46646218-46646240 GAGCCACCGCACCCGGCCTAAGG - Intronic
1148388890 17:47255702-47255724 GAGCCACCGCACCCGGCCAAGGG + Intronic
1148470977 17:47893090-47893112 GAGCCACTGCACCCGGAGGAAGG - Intergenic
1148531080 17:48392708-48392730 GAGCCACCACACCTGGCTAAAGG - Intronic
1148701055 17:49587171-49587193 GAGCCACCGCACCCGGCCTCTGG - Intergenic
1148915127 17:50970231-50970253 GAGCCACCGCACCCGGCCCTTGG - Intronic
1148933184 17:51143707-51143729 GTGCCACCATACCCAGCTAATGG - Intergenic
1149652609 17:58285770-58285792 GAGCCACCGTGCCTGGCTGAGGG - Intergenic
1149703389 17:58673987-58674009 GAGACACCGCACCCGGCCCAGGG - Intronic
1149730176 17:58937590-58937612 GAGCCACCACACCCGGCCGTAGG - Intronic
1149830344 17:59866382-59866404 GTGCTACCACACCCGGCTAAAGG + Intronic
1149871257 17:60184000-60184022 GAGCCACTGCGCCCGGCTGACGG - Intronic
1149901484 17:60483675-60483697 GAGCCACCGCACCTAGCCGATGG + Intronic
1149972354 17:61231726-61231748 GTGTCACCACACCTGGCTAATGG - Intronic
1150185618 17:63178045-63178067 GAGCCACCGCACCTGGCCCAGGG - Intronic
1150345674 17:64402975-64402997 GAGCCACCGCACCGGGCCTAGGG - Intronic
1150372690 17:64654543-64654565 GAGCCACCGCACCCAGCTGATGG - Intronic
1150691326 17:67369644-67369666 GAGCCACAGCGCCCAGCTGAAGG + Intergenic
1150710242 17:67525051-67525073 GAGCCACCGCGCCCGGCCGAAGG + Intronic
1150731587 17:67699683-67699705 GAGCCACTGAACCCGGCTGAGGG - Intergenic
1150799036 17:68264144-68264166 GCGCCACCACGCCCAGCTGAAGG + Intronic
1151339162 17:73458719-73458741 GAGCCACTGCACCCGGCCAAGGG - Intronic
1151420584 17:73994478-73994500 GAGCCACCGCACCCGGCCTATGG - Intergenic
1151488954 17:74420718-74420740 GAGCCACCGCGCCTGGCCGAAGG + Intergenic
1151582847 17:74989921-74989943 GAGCCACCACGCCCGGCTGGTGG + Intronic
1151666516 17:75548425-75548447 GTGCCACCACGCCCGGCTAAAGG + Intronic
1151695709 17:75715914-75715936 GAGCCACCGCACCCGGCTACAGG + Intergenic
1151790640 17:76303584-76303606 GAGCCACCGCGCCCGGCCGCTGG - Intronic
1151838392 17:76599517-76599539 GAGCCACCGCACCCGGCCCAAGG - Intergenic
1151873013 17:76849371-76849393 GAGCCACCGCGCCCGGCTGGAGG + Intergenic
1151918913 17:77139780-77139802 GAGCCACCGCGCCCGGCCGGTGG + Intronic
1152094476 17:78265170-78265192 GTGCCACCGCATCTGGCTCTAGG + Intergenic
1152196154 17:78919548-78919570 GAGCCACCGCACCCAGCAGATGG - Intronic
1152208427 17:78989593-78989615 GAGCCACCGCGCCCGGCCCACGG - Intergenic
1152243356 17:79171885-79171907 GAGCCACCGCACCCAGCCAAAGG - Intronic
1152457132 17:80422981-80423003 GAGCCACCGCGCCCGGCCTAGGG + Intronic
1152680365 17:81664789-81664811 GAGCCACCACACCCGGCTGGGGG + Intergenic
1152711815 17:81874938-81874960 GAGCCACTGCACCCGGCCTATGG - Intergenic
1152796857 17:82312175-82312197 GAGCCACCGCGCCCGGCCCATGG + Intergenic
1152859310 17:82686394-82686416 GAGCCACCGCGCCCGGCCAAGGG + Intronic
1152859525 17:82687785-82687807 GAGCCACCGCGCCTGGCTGGGGG - Intronic
1152942291 17:83178981-83179003 GTGCCGCCTCTCCTGGCTGAGGG + Intergenic
1153184864 18:2474653-2474675 GAGCCACTGCACCTGGCTGAAGG - Intergenic
1153283291 18:3434250-3434272 AAGCCACCGCACCCGGCCCAAGG - Intronic
1153301807 18:3598064-3598086 GAGCCACCGCACCCGGCCCAAGG - Intronic
1153370325 18:4307997-4308019 GAGCCACCGTGCCCGGCCGAGGG + Intronic
1153550029 18:6252917-6252939 GAGCCACCGCACCCGGCCCCAGG - Intronic
1153823512 18:8853658-8853680 GAGCCACCGCGCCCGGCCAAAGG + Intergenic
1153974059 18:10251319-10251341 GAGCCACCGCGCCCGGCCCATGG - Intergenic
1154086061 18:11306754-11306776 GAGCCACCGCACCCGGCCCAAGG - Intergenic
1154409290 18:14128003-14128025 AAGCCACCGCGCCCGGCTGGTGG - Intronic
1154410884 18:14141711-14141733 GAGCCACCACACCCAGCCGAGGG + Intergenic
1154975974 18:21458253-21458275 GAGCCACCGCGCCCGGCCCAAGG + Intronic
1155958028 18:31970045-31970067 GAGCCACTGCACCCGGCCAAAGG + Intergenic
1156243375 18:35274319-35274341 GAGCCACCGTGCCCGGCCGAAGG + Intronic
1156248666 18:35329641-35329663 GGGCCACTGCACCTGGCTCATGG + Intergenic
1156253090 18:35370795-35370817 GAGCCACCGCGCCCGGCCCATGG + Intronic
1157181249 18:45500291-45500313 GAGCCACCGCGCCCGGCCTAAGG - Intronic
1157513006 18:48291911-48291933 GAGCCACCACGCCCGGCTAATGG - Intronic
1157515399 18:48307563-48307585 GAGCCACCGCACCCGGCCAGAGG - Intronic
1158045014 18:53145395-53145417 GAGCCACCGCACCCAGCCCAGGG + Intronic
1158243379 18:55403197-55403219 GTGCCACTGGTACCGGCTGATGG + Intronic
1158481913 18:57829515-57829537 GAGCCACCGCACCCAGCAAAAGG + Intergenic
1158510158 18:58083401-58083423 GAGCCACCGCACCCGGCCCCTGG - Intronic
1158889908 18:61863149-61863171 GAGCCACCGCGCCTGGCTAAGGG - Intronic
1158940352 18:62401739-62401761 GAGCCACCGCACCGGGCCAAAGG + Intergenic
1158940677 18:62403911-62403933 GAGCTACCGCGCCCGGCTCAGGG + Intergenic
1159069932 18:63612350-63612372 GAGCCACCGCGCCCGGCCAAGGG - Intergenic
1159074856 18:63668721-63668743 GAGCCACCACACCTGGCTTAGGG - Intronic
1159399050 18:67906665-67906687 GAGCCACCGCGCCCGGCCCAGGG - Intergenic
1159588319 18:70303507-70303529 GAGCCACCGCACCCAGCTGAAGG - Intronic
1159708088 18:71718094-71718116 GAGCCACCGCGCCCGGCCGACGG + Intergenic
1159902368 18:74059646-74059668 GTGCCACCACACCTGGCTACTGG - Intergenic
1159907226 18:74105587-74105609 GTGCCACCATACCCAGCTTATGG + Intronic
1160231043 18:77049201-77049223 GAGCCACCGCACCCGGCCGAGGG + Intronic
1160259486 18:77278998-77279020 GAGCCACCGCACCCGGCCAGGGG - Intergenic
1160357035 18:78237293-78237315 GAGCCACCGCGCCCGGCCTAGGG - Intergenic
1160391563 18:78538102-78538124 GAGCCACCGCACCCGGCCGACGG - Intergenic
1160594973 18:79966862-79966884 GAGCCACTGCACCCGGCCGGAGG - Intronic
1160737487 19:670553-670575 CTCACACCGCACCCGGCTGATGG + Intergenic
1160756703 19:761237-761259 GTGCCACCACTCCTGGCTAAAGG + Intronic
1160756934 19:762535-762557 GAGCCACCGCACCCAGCCAAAGG + Intronic
1160768213 19:818096-818118 GAGCCACCGCACCCGGCCCATGG - Intronic
1160771681 19:834951-834973 GAGCCACCGCGCCCGGCCAACGG + Intergenic
1160823909 19:1070766-1070788 GATCCACCGCGCCCGGCTGGGGG + Intronic
1160828649 19:1092286-1092308 GAGCCACCGCACCCGGCCTCAGG - Intronic
1160830570 19:1103015-1103037 GAGCCACCGCATCCGGCCAAGGG - Intergenic
1161040093 19:2105809-2105831 GAGCCCCCGCGCCCGGCTGACGG - Intronic
1161136356 19:2622361-2622383 GAGCCACCGCGCCCGGCTCCTGG + Intronic
1161225182 19:3141169-3141191 GTGCCACCATACCCGGCTCACGG - Intronic
1161289520 19:3485588-3485610 GTGCCACCGCACCCAGCCTTGGG + Intergenic
1161339734 19:3734668-3734690 GAGCCACCGCACCTGGCCTAAGG - Intronic
1161442038 19:4297351-4297373 GAGCTACCGCGCCCAGCTGATGG + Intronic
1161486328 19:4537849-4537871 GAGCCCCCGCACCCGGCCAAAGG + Exonic
1161504168 19:4635241-4635263 GAGCCACCGCGCCCGGCTGCCGG + Intergenic
1161540569 19:4848580-4848602 GAGCCACTGCACCCGGCCTACGG - Intronic
1161623486 19:5311754-5311776 GAGCCACCGCACCCGGCCCAAGG - Intronic
1161681902 19:5684298-5684320 GAGCCACCACATCCAGCTGAAGG + Intronic
1161696501 19:5771520-5771542 GAGCCACTGCGCCCGGCCGATGG + Intronic
1161734713 19:5984529-5984551 GAGCCACCACGCCCAGCTGAGGG + Intergenic
1161789663 19:6351770-6351792 GAGCCACCACACCCGGCCTAAGG - Intergenic
1161950639 19:7465799-7465821 GAGCCACCGCACCCAGCCAAAGG - Intronic
1162010735 19:7812967-7812989 GAGCCACCGCACCTGGCTCTAGG - Intergenic
1162240499 19:9349231-9349253 GAGCCACCGCACCCAGCTTCTGG + Intronic
1162315839 19:9937340-9937362 GAGCCACCGCGCCCGGCCTAGGG - Intergenic
1162335976 19:10060679-10060701 GAGCCACCGCGCCCGGCCCATGG - Intergenic
1162339395 19:10083045-10083067 GAGCCACCGCGCCTGGCTGATGG + Intergenic
1162573601 19:11486241-11486263 GAGCCACCGCACCTGGCCAAGGG + Intronic
1162601461 19:11673332-11673354 GAGCCACCGCACCCGGCCTCTGG + Intergenic
1162608494 19:11731026-11731048 GAGCCACCTCACCCGGCTGCGGG - Intronic
1162724841 19:12683858-12683880 GAGCCACTGCGCCCGGCCGAGGG + Intergenic
1162743619 19:12786881-12786903 GAGCCACCGCACCCCACTGAGGG - Intronic
1162813177 19:13177000-13177022 GAGCCACCGCGCCCGGCCTATGG - Intergenic
1162907554 19:13832806-13832828 GAGCCACCGCGCCCGGCCGCTGG - Intergenic
1162926947 19:13935609-13935631 GAGCCACTGCACCCGGCCGAGGG + Intronic
1162950596 19:14070023-14070045 GAGCCACCGCGCCCGGCTTCTGG - Intergenic
1162984253 19:14259259-14259281 GAGCCATCTCATCCGGCTGATGG + Intergenic
1162984299 19:14259584-14259606 GAGCCACCGCGCCCGGCCGATGG + Intergenic
1163050628 19:14680785-14680807 GAGCCACCGCACCCGGCCAATGG - Intronic
1163164190 19:15484003-15484025 GAGCCACCGCACCCGGCCAAGGG - Intronic
1163211886 19:15846922-15846944 GAGCCACTGCGCCCAGCTGAAGG + Intergenic
1163330279 19:16632150-16632172 GAGCCACCACACCCGGCCGCTGG + Intronic
1163640579 19:18459808-18459830 GAGCCACCGCGCCCGGCCCATGG + Intronic
1163670229 19:18623313-18623335 GAGCCACCACACCCGGCCAAGGG - Intergenic
1163686109 19:18712673-18712695 GGGCAACTGCACCCGGCTAAGGG - Intronic
1163734309 19:18969578-18969600 GAGCCACCGCACCCGGCCTGAGG + Intergenic
1163927738 19:20361716-20361738 GAGCCACCGCACCTGGCCCAGGG - Intergenic
1163937777 19:20465611-20465633 GAGCCACCACACCCAGCTGATGG - Intergenic
1164052085 19:21592392-21592414 GAGCCACCACACCCGGCCGTGGG + Intergenic
1164315747 19:24086759-24086781 GAGCCACCGCGCCCAGCTGATGG + Intronic
1164617673 19:29676600-29676622 GAGCCACCACACCCGGCCAAGGG + Intergenic
1164995070 19:32715200-32715222 GTGCCACTGCACCTGGCTAATGG + Intergenic
1165073081 19:33266938-33266960 GAGCCACTGCACCCGGCTCCAGG + Intergenic
1165189177 19:34048034-34048056 GAGCCACCGCGCCCGGCCCATGG + Intergenic
1165447405 19:35864057-35864079 GAGCCACCGCGCCCGGCCAAGGG + Intronic
1165455978 19:35910912-35910934 GAGCCACTGCACCTGGCTGAGGG - Intergenic
1165469376 19:35994572-35994594 GAGCCACCGCGCCCGGCTACCGG - Intergenic
1165595886 19:37011036-37011058 GTGCCACCGCCACAGGCTGAGGG - Intronic
1165601822 19:37060399-37060421 GTGCCACCGCCACGGGCTGAGGG - Intronic
1165635678 19:37337725-37337747 GAGCCACAGCCCCCGGCCGAGGG + Intronic
1165648869 19:37468788-37468810 GAGCCACCGTGCCAGGCTGAGGG + Intronic
1165668185 19:37652280-37652302 GAGCCACCGTACCCGGCTGGTGG - Intronic
1165758327 19:38306963-38306985 GAGCCACCGCGCCCGGCAAAAGG + Intronic
1165884460 19:39067801-39067823 CCGCCACCACTCCCGGCTGAGGG + Intergenic
1165926818 19:39331624-39331646 CTGCCACTGCACCCTGCTAAAGG - Intronic
1165942002 19:39419310-39419332 GAGCCACCACAGCCAGCTGATGG - Intronic
1166032816 19:40145797-40145819 GAGCCACCTCACCCAGCCGAGGG - Intergenic
1166033711 19:40152088-40152110 GAGCCACCACGCCTGGCTGATGG + Intergenic
1166055565 19:40286096-40286118 GAGCCACCGCGCCCGGCCGCAGG - Intergenic
1166064563 19:40349672-40349694 GAGCCACCGCACCCGGCCGAGGG - Intronic
1166194105 19:41194829-41194851 TAGCCACTGCACCCGGCTGATGG - Intronic
1166287006 19:41837399-41837421 GAGCCACTGCACCTGGCTGAAGG - Intronic
1166291547 19:41866730-41866752 GAGCCACCGCACCCGGCCCCTGG - Intronic
1166552997 19:43679185-43679207 GAGCCACCGCGCCCGGCCTAGGG - Intergenic
1166693404 19:44838221-44838243 GAGCCACCGCACCTGGCCTAAGG - Intergenic
1166761999 19:45230631-45230653 GAGCCACCGCGCCCGGCCAAGGG + Intronic
1166937899 19:46346015-46346037 GAGCCACCGTGCCCGGCCGAGGG - Intergenic
1166966580 19:46532866-46532888 GAGCCACCGTGCCCGGCTGGTGG + Intronic
1167036279 19:46996871-46996893 GAGCCACCGCACCCGGCCATGGG - Intronic
1167158466 19:47753157-47753179 GAGGCACCGCACCCGGCCAAGGG - Intronic
1167167897 19:47811779-47811801 GAGCCACCGCGCCCGGCTAATGG + Intronic
1167444019 19:49526771-49526793 GAGCCACCGCGCCCGGCCTAAGG + Intergenic
1167634571 19:50647112-50647134 GAGCCACCGCGCCTGGCTGCGGG + Intronic
1167685921 19:50956234-50956256 GAGCCACCGCACCCGGCCTATGG + Intergenic
1167750864 19:51379506-51379528 GAGCCACTGCACCCGGCCCAGGG - Intergenic
1167822204 19:51938411-51938433 GTGCCACCACATCCAGCTGATGG + Intronic
1167951177 19:53028992-53029014 GAGCCACCGCGCCAGGCTCAAGG - Intergenic
1168130346 19:54313820-54313842 GAGCCACTGCGCCCGGCTGGTGG + Intergenic
1168208332 19:54869426-54869448 GAGCCACCGCGCCCGGCCTATGG - Intergenic
1168259761 19:55186758-55186780 GAGTCACTGCACCCGGCTGTGGG - Intronic
1168285386 19:55329519-55329541 GAGCCACCGTGCCCGGCTTAGGG + Intronic
1168396467 19:56052945-56052967 GTGCCACCACACCTGGCTAAAGG - Intronic
1168476043 19:56676024-56676046 GGGCCACCACACCCGGCCCATGG - Intergenic
1168501263 19:56895616-56895638 GAGCCACCGCACCCGGCCAAAGG - Intergenic
1168558258 19:57361929-57361951 GAGCCACAGCACCCGGCCAAAGG - Intergenic
1168656816 19:58135548-58135570 GAGCCACTGCACCCGGCAGGTGG + Intronic
1168688172 19:58361064-58361086 GAGCCACGGCACCCGGCCGGTGG + Intronic
925123169 2:1435215-1435237 GAGCCACCGTACCCGGCCAATGG + Intronic
925575792 2:5358512-5358534 GAGCCACCACGCCCGGCTGGTGG - Intergenic
925881216 2:8354376-8354398 GTGCCACCAAACCCCTCTGACGG + Intergenic
926058591 2:9791293-9791315 GAGCCACCGCACCTGGCCAAAGG - Intergenic
926185516 2:10687672-10687694 GAGCCACTGCACCCGGCCCAAGG - Intronic
926205221 2:10830833-10830855 GTGCCACCCCCGCCGGCTGGTGG + Intronic
926247275 2:11130747-11130769 GAGCCACCGCGCCCGGCTGGAGG - Intergenic
926266980 2:11331991-11332013 ATGCCACTGCACCTGGCTAATGG - Intronic
926536699 2:14121982-14122004 GAGCCACTGCACCCGGCCGTGGG + Intergenic
926841300 2:17083364-17083386 GAGCCACCGTGCCCGGCCGAGGG + Intergenic
927545853 2:23952249-23952271 GAGCCATCACACCCGGCTGCTGG + Intronic
927579613 2:24230481-24230503 GAGCCACCGCACCCAGCCAAGGG - Intronic
927805232 2:26141067-26141089 GAGCCACCGCGCCCGGCCCATGG + Intergenic
927917959 2:26948572-26948594 GAGCCACCGCACCCGGCCAGGGG - Exonic
928035279 2:27816879-27816901 GAGCCACCGCGCCCGGCCTAAGG + Intronic
928055207 2:28046168-28046190 GAGCCACCGCGCCCGGCCAAGGG - Intronic
928139483 2:28715959-28715981 GAGCCACCACACCCGGCCCAAGG + Intergenic
928206552 2:29288664-29288686 GAGCCACCGCACCCAGTTCAAGG - Intronic
928482669 2:31698269-31698291 GAGCCACCGCACCCGGCCTGTGG + Intergenic
928568226 2:32575478-32575500 GAGCCACCGCACCCAGCCGAGGG - Intronic
928659309 2:33484912-33484934 GAGCCACTGCACCCGGCCAAGGG - Intronic
929217297 2:39428783-39428805 GAGCCACTGCACCCGGCCCATGG - Intronic
929497886 2:42462412-42462434 GAGCCACTGCACCCGGCTAAGGG - Intronic
929589346 2:43134890-43134912 GAGCCACCACGCCCGGCCGAGGG - Intergenic
929867912 2:45734080-45734102 GAGCCACCGCACCCAGCCCAGGG - Intronic
929903767 2:46028224-46028246 GAGCCACCGCGTCCGGCCGAAGG + Intronic
929923705 2:46192434-46192456 GAGCCACTGCACCCGGCAGGGGG - Intergenic
929971293 2:46579564-46579586 GAGCCACTGCACCCAGCTGAGGG - Intronic
930175217 2:48294616-48294638 GAGCCACTGCACCCGGCCAAAGG - Intergenic
930547197 2:52783325-52783347 CTGCCACTGCACTTGGCTGAAGG + Intergenic
930635927 2:53805304-53805326 GAGCCACCGCACCCAGCTACAGG + Intronic
930700884 2:54456872-54456894 GGGCCGCCGCGCCCGGCTGCAGG - Intronic
930704726 2:54493288-54493310 GAACCACCGCACCCGGCCTAAGG + Intronic
931125487 2:59271579-59271601 GTGCCACCACACCCGGCCTCAGG + Intergenic
931270576 2:60698601-60698623 GAGCCACCGCGCCCGGCCTAAGG + Intergenic
931326148 2:61226109-61226131 GTGCCACCACACCTGGCTGAGGG + Intronic
931374646 2:61696218-61696240 GAGCCACCGCGCCCGGCCAAGGG - Intergenic
931419191 2:62110352-62110374 GAGCCACCACACCCAGCTGAAGG + Intronic
931420216 2:62120283-62120305 GAGCCACTGCACCCAGCTGTGGG + Intronic
931422238 2:62138918-62138940 GTGCTACCACACCTGGCTAACGG - Intronic
931468514 2:62513926-62513948 GAGCCACCGCACCCGACCCATGG + Intergenic
931658218 2:64529867-64529889 GAGCCACTGCGCCTGGCTGAGGG - Intronic
931887651 2:66634416-66634438 GAGCCACCGCGCCCGGCCAAAGG - Intergenic
932169800 2:69543688-69543710 GAGCCACCGCGCCCGGCCTATGG + Intronic
932243864 2:70180005-70180027 GAGCCACCGCACCCGGCCCAAGG - Intronic
932359762 2:71094382-71094404 GAGCCAGTGCACCCAGCTGAAGG + Intergenic
932527241 2:72484272-72484294 GAGCCACCGCGCCCAGCTGAGGG - Intronic
932675956 2:73781335-73781357 GAGCCACCGCACCTGGCCAATGG + Intergenic
933154690 2:78960356-78960378 GAGCCACAGCACCCGGCCGCCGG + Intergenic
933487913 2:82946777-82946799 GAGCCACTGCACCCAGCCGAAGG + Intergenic
933692039 2:85186249-85186271 GAGCCACCGCGCCCGGCCGCAGG + Intronic
934150189 2:89139514-89139536 GAGCCACCGCGCCCGGCCGAAGG + Intergenic
934217106 2:90042521-90042543 GAGCCACCGCGCCCGGCCGAAGG - Intergenic
934696913 2:96406589-96406611 GAGCCACCGCGCCTGGCCGATGG + Intergenic
934762457 2:96864174-96864196 GTGCCATCCCACCCTGCTGATGG - Intronic
934795576 2:97096045-97096067 GAGCCACCGCACCCGGCCATAGG - Intergenic
934848133 2:97676472-97676494 GAGGCACCGCACCCGGCCAAGGG - Intergenic
935027572 2:99292000-99292022 GAGCCACTGCGCCCGGCCGAGGG - Intronic
935051787 2:99530641-99530663 GAGCCACCGCGCCCGGCCAATGG + Intergenic
935209770 2:100929187-100929209 GAGCCACTGCACCCGGCCCATGG + Intronic
935267175 2:101404709-101404731 GAGCCACCACACCCGGCTCAGGG + Intronic
935634384 2:105238503-105238525 GAGCCACCGCGCCCCGCTGAAGG + Intergenic
935820645 2:106888830-106888852 GAGCCACCGCGCCAGGCTGAAGG - Intergenic
936119725 2:109731070-109731092 GAGCCACCGCGCCCGGCCAAGGG + Intergenic
936369911 2:111895264-111895286 GAGCCACTGTACCCAGCTGATGG + Intergenic
936414020 2:112287884-112287906 GAGCCACCGCCCCCGGCCGTTGG + Intronic
936573751 2:113636702-113636724 GAGCCACCGCACCCGGCCCATGG - Intronic
936625290 2:114142088-114142110 GAGCCACCGCGCCTGGCTGAGGG - Intergenic
936698133 2:114975326-114975348 GAGCCACCGTGCCTGGCTGAAGG + Intronic
936699075 2:114988086-114988108 GAGCCACCGCGCCCGGCCGCCGG + Intronic
936990094 2:118354666-118354688 GAGCCACCGCACCCGGCCTGAGG - Intergenic
937390912 2:121485577-121485599 GAGCCACCGTACCCAGCTCATGG - Intronic
937415508 2:121711375-121711397 GAGCCACTGAACCCGGCTGGGGG - Intergenic
937493906 2:122398281-122398303 GAGCCACCGCGCCCGGCCCAAGG - Intergenic
937510895 2:122593905-122593927 GAGCCACCACACCCAGCCGATGG + Intergenic
937856753 2:126677935-126677957 GAGCCGCTGCACCCGGCCGATGG - Intronic
938386055 2:130868207-130868229 GAGCCACCACACCCGGCCAAGGG + Intronic
938450695 2:131416980-131417002 AAGCCACCACACCCGGCCGAAGG - Intergenic
938590380 2:132730207-132730229 GAGCCACCGCACCTGGCTTTGGG - Intronic
938644881 2:133320442-133320464 GAGCCACCGCACCCAGCCAAGGG - Intronic
938835214 2:135095330-135095352 GAGCCACCGCGCCCGGCCGCAGG + Intronic
938898081 2:135772752-135772774 GAGCCACCGCGCCCGGCTATTGG - Intronic
938963411 2:136363154-136363176 GAGCCACCGCACCCGGCCTCAGG - Intergenic
939372085 2:141314505-141314527 GAGCCACCGCGCCCGGCCGTAGG - Intronic
939984202 2:148814122-148814144 GAGCCACTGCACCTGGCTGAAGG - Intergenic
940106061 2:150101675-150101697 ATGCCACCACAGCCGGCTGGTGG - Intergenic
940208045 2:151225813-151225835 GAGCCACCGCGCCCGGCCGGGGG - Intergenic
940221725 2:151359670-151359692 GAGCCACCGCACCTGGCCCAGGG + Intronic
940401055 2:153248528-153248550 GAGCCACCACGCCCGGCCGAGGG - Intergenic
940867291 2:158829984-158830006 GAGCCACCACACCCGGCCGACGG + Intronic
940916163 2:159258372-159258394 GAGCCACTGCACCCGGCCAAGGG - Intronic
940918555 2:159284094-159284116 GAGCCACCGTACCCGGCCAAGGG + Intronic
941074528 2:160991870-160991892 GAGCCACTGCACCTGGCTGAAGG - Intergenic
941115201 2:161463863-161463885 GAACCACTGCACCCGGCTTAAGG + Intronic
941630531 2:167879268-167879290 GAGCCACCGCACCCAGCCTAGGG + Intergenic
941873879 2:170413753-170413775 GAGCCACCGCACCCGGCCTAAGG - Intronic
941938355 2:171005459-171005481 GAGCCACTGCACCTGGCTGGTGG - Intronic
942099514 2:172565583-172565605 GAGCCACCGAGCCCAGCTGAGGG + Intronic
942147354 2:173039903-173039925 GAGCCACCACACCCAGCTGGAGG - Intronic
942194044 2:173499240-173499262 GAGCCATCGCACCCGGCCAAGGG + Intergenic
942369508 2:175267411-175267433 GAGCCACCGCGCCCGGCTCTTGG + Intergenic
942717375 2:178908474-178908496 GAGCCACCGCGCCCAGCCGAGGG + Intronic
942999275 2:182304164-182304186 GAGCCACCATACCCGGCCGATGG + Intronic
943032841 2:182705796-182705818 GAGCCACTGCACCCAGCTGAGGG + Intergenic
943050040 2:182902826-182902848 GAGCCACCGCGCCCGGCCTAGGG + Intergenic
943458396 2:188137665-188137687 GAGCCACTGCACCTGGCCGATGG - Intergenic
943765294 2:191654545-191654567 GAGCCACCGCGCCCGGCCTAGGG - Intergenic
943963189 2:194295116-194295138 GAGCCACCGCGCCCGGCCTATGG - Intergenic
943994908 2:194750654-194750676 GAGCCACCGCGCCCGGCCGAGGG - Intergenic
944323554 2:198376970-198376992 GAGCCACCGCGCCCAGCTGAGGG - Intronic
944559683 2:200923532-200923554 GAGCCACCGCATCCGGCTTAAGG + Intronic
944599306 2:201286901-201286923 GAGCCACCGCGCCTGGCCGATGG + Exonic
944649112 2:201811125-201811147 GAGCCACTGCGCCTGGCTGAGGG + Intronic
944730038 2:202506614-202506636 GAGCCACCGCACCCGGCCTATGG - Intronic
944813676 2:203353627-203353649 GTGCCACCACGCCTGGCTGGTGG + Intronic
944908321 2:204284958-204284980 GAGCCACCGCACCTGGCTATGGG + Intergenic
945052476 2:205837090-205837112 GAGCCACCGCACCCGGCCTAAGG - Intergenic
945094356 2:206204707-206204729 GAGCCACCGCACCCGGTTTGTGG + Intronic
945155048 2:206829421-206829443 GAGCCACTGCACCCGGCCGAGGG + Intergenic
945190830 2:207185741-207185763 GAGCCACCGCACCTGGCAAAAGG - Intergenic
945244157 2:207702788-207702810 GAGCCACCGCGCCCGGCCGAAGG + Intergenic
945300573 2:208212589-208212611 GAGCCACCGCACCCGGCCGTTGG - Intergenic
945862461 2:215139557-215139579 GAGCCACCGCACCTGGCGAAGGG - Intergenic
946017353 2:216614672-216614694 GAGCCACCGCACCTGGCCAAGGG - Intergenic
946110001 2:217406601-217406623 GAGCCACCGCACCCGGCCCCTGG - Intronic
946210642 2:218144549-218144571 GACCCACCACACCCGGCTGTTGG + Intergenic
946296839 2:218791118-218791140 GAGCCACTGTACCCAGCTGAGGG + Intronic
946578910 2:221105300-221105322 GAGCCACCGCGCCCGGCCTAAGG - Intergenic
946828397 2:223702806-223702828 GAGCCACCGCACCCTGCCTAAGG - Intergenic
946847230 2:223870102-223870124 GAGCCACCATGCCCGGCTGATGG + Intronic
946938034 2:224742240-224742262 GAGCCACCCCACCCGGCCGATGG - Intergenic
946953672 2:224905531-224905553 GAGCCACCGCGCCCGGCCTATGG + Intronic
947226704 2:227847577-227847599 GAGCCACCGCGCCCGGCCGGAGG - Intergenic
947423122 2:229958551-229958573 GAGCCACCGCACCCTGCCGAGGG + Intronic
947425956 2:229983089-229983111 GAGCCACCGCGCCCGGCAGGAGG - Intronic
947431565 2:230033093-230033115 ATGCCACCACACCTGGCTAATGG + Intergenic
947493688 2:230617448-230617470 GAGCCACCCCGCCCGGCTAAGGG - Intergenic
947559049 2:231130091-231130113 GAGCCACCACACCCGGCCAATGG + Intronic
947764631 2:232629616-232629638 GTGTCACCACGCCCGGCTAACGG + Intronic
948001962 2:234575374-234575396 GAGCCACCGCACCCGGCCCGTGG + Intergenic
948243968 2:236462385-236462407 GAGCCACCGCACCCGGCGCCTGG - Intronic
948938740 2:241185520-241185542 GAGCCACCGCACCCGGCCTTGGG - Intergenic
948980812 2:241493879-241493901 GAGCCACCGCACCCGGCCCCAGG + Exonic
949044092 2:241862812-241862834 GAGCCACCACACCTGGCTGATGG + Intergenic
949064138 2:241979614-241979636 GAGCCACCGCACCTGGCTGAGGG + Intergenic
1168826133 20:815513-815535 GAGCCACCGCACCCGGCCTGCGG - Intergenic
1169041491 20:2499179-2499201 GAGCCACCGCGCCCGGAAGAGGG - Intronic
1169153450 20:3308667-3308689 GAGCCACCGCACCTGGCTGGAGG - Intronic
1169216317 20:3796577-3796599 GCGCCACCGCACACGCCTGCTGG - Exonic
1169362835 20:4965680-4965702 GAGCCACCGCGCCCGGCTGAGGG - Intronic
1169453134 20:5729206-5729228 GAGCCACTGCACCCAGCTGCAGG + Intergenic
1169495508 20:6111084-6111106 GAGCCACCACACCCGGCTAATGG + Intronic
1169587484 20:7102334-7102356 GAGCCACCGCACCCGGCCAAAGG - Intergenic
1169842480 20:9955364-9955386 GAGCCACCGCGCCCGGCCTAGGG - Intergenic
1169893439 20:10477549-10477571 GAGCCACCGTGCCCGGCCGAAGG + Intronic
1170115920 20:12859325-12859347 GAGCCACCGCACCTGGCCAAAGG + Intergenic
1170148374 20:13202035-13202057 GAGCCACCGCGCCTGGCAGATGG + Intergenic
1170204429 20:13783545-13783567 GAGCCACCGCACTCGGCCTAGGG - Intronic
1170743852 20:19081069-19081091 GAGCCACCGCGCCCGGCCCAGGG + Intergenic
1171284040 20:23923328-23923350 GTGCCACCGGACCCTGGTCAGGG + Intergenic
1171504937 20:25625246-25625268 GAGCCACCGCGCCTGGCTAAGGG + Intergenic
1171781381 20:29421755-29421777 GAGCCACCACACCGGGCAGATGG - Intergenic
1172089610 20:32419962-32419984 GAGCCCCCACACCCGGCTGATGG + Intronic
1172135345 20:32682947-32682969 GAGCCACCGCACCCGGCCAGGGG - Intergenic
1172160068 20:32861612-32861634 ATGCCACCACACCAGGCTCATGG - Intronic
1172237429 20:33387780-33387802 GAGCCACCGCACCTGGCTGGTGG - Intronic
1172323849 20:34019036-34019058 GAGCCACTGCGCCCGGCCGAGGG - Intronic
1172428280 20:34871050-34871072 GAGCCACCGCGCCCGGCCTATGG + Intronic
1172571141 20:35971698-35971720 GAGCCACCGCACCTGGCCTAGGG + Intronic
1172849346 20:37949501-37949523 AAGCCACCGCACCCGGCTGGGGG + Intergenic
1172994834 20:39062796-39062818 GTGCCACCACGCTCGGCAGATGG + Intergenic
1173308249 20:41872139-41872161 GAGCCACCGCGCCCGGCCCAGGG + Intergenic
1173648266 20:44647148-44647170 GAGCCACCGCACCCGGCCAAGGG - Intronic
1173671020 20:44799016-44799038 GAGCCACCACACCCGGCTCAAGG - Intronic
1174245559 20:49177192-49177214 GAGCCACCGCACCTGGCCCAGGG + Intronic
1174377693 20:50137323-50137345 GAGCCACCGCACCCAGCCGAGGG + Intronic
1174451266 20:50622081-50622103 GTGCCAGGGCGCCTGGCTGATGG - Intronic
1174464818 20:50709027-50709049 GAGCCACCGCACCTGGCTGCTGG + Intergenic
1174505178 20:51013017-51013039 GAGCCACCGCACCCGGTCGAGGG - Intronic
1174629215 20:51941686-51941708 GAGCCACCGTGCCCGGCCGAGGG - Intergenic
1174958107 20:55123754-55123776 GAGCCACCGCGCCCGGCAGTAGG - Intergenic
1175618567 20:60424047-60424069 GAGCCACCGCACCTGGCCGAGGG + Intergenic
1175691699 20:61069967-61069989 GAGCCACCACACCCGGCAGCTGG - Intergenic
1175855511 20:62118823-62118845 GTGCAACAGCACCAGCCTGAAGG - Intergenic
1176001516 20:62833685-62833707 GAGCCACCGCGCCCGGCCGGGGG + Intronic
1176154548 20:63611845-63611867 GTGCCACCACGCCTGGCTAATGG - Intronic
1176155315 20:63617122-63617144 TTACCACCGCACCCAGCTGGTGG + Intronic
1176728830 21:10469111-10469133 GAGCCACCACACCCGGCCTAGGG - Intergenic
1176862173 21:14016708-14016730 GAGCCACCACACCCAGCTGAGGG - Intergenic
1176863939 21:14031886-14031908 GAGCCACCGCGCCTGGCTGGTGG + Intergenic
1176929544 21:14791714-14791736 GAGCCACCGTGCCCGGATGAAGG + Intergenic
1176959406 21:15142270-15142292 GAGCCACCACACCTGGCTGCAGG + Intergenic
1177164312 21:17582294-17582316 GAGCCACCGCAGCCCGCTGGAGG + Intronic
1177204186 21:17992935-17992957 GAGCCACGGCGCCCGGCCGAGGG + Intronic
1177303474 21:19282013-19282035 GAGCCACCGCGCCCGGCGGAAGG - Intergenic
1177504365 21:22001062-22001084 GAGCCACTGCACCCGGCCTAGGG - Intergenic
1177557634 21:22713174-22713196 GAGCCACCGCACCTGGCCTAGGG - Intergenic
1177636849 21:23798280-23798302 GAGCCACTGCACCCTGCCGAAGG + Intergenic
1177757510 21:25364897-25364919 GAGCCACTGCGCCCGGCCGAGGG + Intergenic
1177817344 21:25991660-25991682 GAGCCACTGCACCCAGCTGCTGG + Intronic
1177892589 21:26824691-26824713 GAGCCACCACGCCCGGCCGATGG - Intergenic
1178120143 21:29461211-29461233 GAGCCACCGCGCCCGGCCCATGG + Intronic
1178235287 21:30834504-30834526 GAGCCACCGTGCCCGGCCGATGG + Intergenic
1179472106 21:41618078-41618100 GGGCCACCGCGCCCGGCTCATGG - Intergenic
1179569554 21:42269979-42270001 GAGCCACCGCGCCCGGCCCAGGG - Intronic
1179830410 21:43992909-43992931 GAGCCACCGCGCCCGGCCGAGGG - Intergenic
1180092119 21:45538567-45538589 CTGCCAGGGCACGCGGCTGATGG - Intronic
1180559773 22:16606484-16606506 GAGCCACCGCACCTGGCCCAGGG + Intergenic
1180624294 22:17183744-17183766 GAGCCACCGCACCGGGCTCTGGG + Intronic
1180655185 22:17414254-17414276 GAGCCACTGCGCCCGGCGGAAGG + Intronic
1180723620 22:17928153-17928175 GAGCCACCGCGCCCGGCCCACGG - Intronic
1180795319 22:18601139-18601161 GAGCCACTGCACCCGGCCTATGG - Intergenic
1180989853 22:19929041-19929063 GAGCCACCGCGCCCGGCCTATGG - Intronic
1181096723 22:20510100-20510122 GAGCCACCACACCTGGCTAAAGG - Intronic
1181226421 22:21394173-21394195 GAGCCACTGCACCCGGCCTATGG + Intergenic
1181252229 22:21540665-21540687 GAGCCACTGCACCCGGCCTATGG - Intergenic
1181298952 22:21866102-21866124 GAGCCACCGCGCCCGGCTGATGG - Intronic
1181531574 22:23520509-23520531 GAGCCACCACACCCGGCCCATGG + Intergenic
1181568115 22:23751780-23751802 GAGCCACCGCGCCCGGCCAAGGG - Intergenic
1181627700 22:24132870-24132892 GAGCCACCGCGCCCAGCTGCTGG + Intronic
1181633677 22:24164504-24164526 GGACCACAGCACCCTGCTGAAGG + Exonic
1181864568 22:25845232-25845254 GAGCCACCGCGCCCGGCCAAGGG - Intronic
1181946627 22:26522793-26522815 GAGCCACCGCACCTGGCTCCTGG - Intergenic
1182090298 22:27590158-27590180 GAGCCACTGCGCCTGGCTGAGGG - Intergenic
1182095512 22:27622826-27622848 GAGCCACCGCGCCCGGCCGAGGG + Intergenic
1182260830 22:29072411-29072433 TAGCCACCGCACTCGGCTGTAGG + Intergenic
1182445712 22:30387994-30388016 GAGCCACCGCGCCCGGCCTATGG - Intronic
1182462678 22:30493717-30493739 GAGCCACCGCACCCGGCCTCTGG - Intronic
1182611326 22:31550079-31550101 GTGCCACCACACCCGGCACACGG + Intronic
1182749186 22:32628107-32628129 GAGCCACCGCACCCGGCCAGAGG + Intronic
1182796927 22:32997740-32997762 GAGCCACCGCGCCCGGCCGGTGG - Intronic
1182861018 22:33559464-33559486 GAGCCACCACACCCTGCTGATGG + Intronic
1182876135 22:33692593-33692615 GAGCCACCGCGCCCGGCCAATGG + Intronic
1182906169 22:33938361-33938383 GAGCCACCGCACCCAGCCCAGGG + Intergenic
1183151734 22:36042917-36042939 GAGCCACCGCACCTGGCGGTAGG + Intergenic
1183232420 22:36591311-36591333 GAGCCACCGCGCCCGGCCTAAGG + Intronic
1183253301 22:36745033-36745055 GAGCCACCGCACCCGGCCGGTGG - Intergenic
1183472109 22:38015088-38015110 GAGCCACCGCACCCGGCCTCTGG + Intronic
1183481411 22:38067591-38067613 GAGCCACCGCACCCGGCCTTGGG + Intronic
1183510860 22:38234051-38234073 GAGCCACCGCGCCCGGCCGACGG + Intronic
1183528743 22:38340620-38340642 GAGCCACCGCGCCCAGCTGGGGG - Intronic
1183589448 22:38771231-38771253 GAGCCACCGCGCCCGGCCAATGG + Intronic
1183637297 22:39072117-39072139 GAGCCACCGCACCCAGCCAACGG - Intronic
1183639814 22:39086018-39086040 GAGCCACAGCGCCCGGCCGAGGG - Intronic
1183690641 22:39386258-39386280 GAGCCATGGCACCCAGCTGAAGG - Intergenic
1183808845 22:40237120-40237142 GTGCCACTGCACTCGGGAGATGG + Intronic
1183876184 22:40783987-40784009 GAGCCACCGCGCCCGGCCAATGG + Intronic
1183905060 22:41034324-41034346 GAGCCACCGCACTCGGCCCAGGG + Intergenic
1183909088 22:41065059-41065081 GAGCCACCGCACCCGGTCAACGG - Intergenic
1184081602 22:42225328-42225350 GAGCCACCGCGCCCGGCCTAAGG - Intronic
1184126606 22:42491799-42491821 GAGCCACCGCGCCCGGCCGGTGG + Intergenic
1184138663 22:42564713-42564735 GAGCCACCGCACCCGGCCTGAGG + Intronic
1184184322 22:42854338-42854360 GAGCCACCGCACCTGGCCAAGGG - Intronic
1184208525 22:43021390-43021412 GTCCCACCACACCTGGCTAATGG + Intergenic
1184209875 22:43029145-43029167 GAGCCACCGCGCCCGGCCGGGGG + Intergenic
1184333281 22:43839307-43839329 GAGCCACCGCACCCGGCCAGAGG - Intronic
1184481535 22:44751126-44751148 GAGCTACCGCACCCGGCCGTGGG - Intronic
1184524490 22:45013801-45013823 GAGCCACCGCGCCCGGCCGCTGG - Intergenic
1184585798 22:45447288-45447310 GAGCCACCGCACCCGGCCAGTGG - Intergenic
1184588893 22:45467621-45467643 GAGCCACCGCACCTGGCCTATGG + Intergenic
1184748362 22:46469796-46469818 GAACCACCGCACCCGGCCTAGGG + Intronic
1184810207 22:46826163-46826185 GAGCCACCACACCCAGCTGGTGG + Intronic
1185145150 22:49129769-49129791 GAGCCACCGCACCCTGTGGAAGG + Intergenic
1185268199 22:49915973-49915995 GAGCCACCGCTCCCGGCTGCTGG - Intronic
1185396743 22:50595637-50595659 GAGCCACCGCACCCAGCCAAGGG - Intronic
949352679 3:3140796-3140818 GACCCACCGTGCCCGGCTGAGGG - Intronic
949569338 3:5276796-5276818 GCGCCACCACACCCTGCTGATGG + Intergenic
949575105 3:5331336-5331358 GAGCCACCGCTCCCGGCCGCAGG + Intergenic
949783898 3:7719526-7719548 GAGCCACCGCGCCCAGCTGTAGG - Intronic
949807829 3:7974856-7974878 GAGCCACTGCACCCGGGAGATGG - Intergenic
949870000 3:8580322-8580344 GAGCCACCGCGCCTGGCTGGAGG - Intergenic
950072557 3:10164561-10164583 GATCCACCGCGCCCGGCTGTAGG + Intergenic
950353077 3:12376231-12376253 GAGCCACCGCACCCGGCCTCAGG + Intronic
950384669 3:12648828-12648850 GAGCCACCGCATCCGGCCGATGG - Intronic
950394410 3:12722781-12722803 GAGCCACCGCACCTAGCTTAGGG - Intergenic
950415411 3:12866435-12866457 GAGCCACCGCGCCCGGCCGGGGG - Intronic
950523655 3:13510748-13510770 GAGCCACCGCGCCCAGCTGACGG + Intergenic
950556298 3:13697985-13698007 GAGCCACCGCGCCCGGCAAAAGG - Intergenic
950698132 3:14720312-14720334 GAGCCACCGTGCCCGGCAGAGGG + Intronic
951022677 3:17797973-17797995 GAGCCACTGCACCCGGCCAAGGG + Intronic
951217950 3:20041346-20041368 GTGCCTCCGCCCCCAGCCGAGGG - Intronic
951321168 3:21247975-21247997 GAGCCACCGCACCTGGCCAATGG - Intergenic
951467022 3:23012533-23012555 GAGCCACCGCACCTGGCACATGG + Intergenic
951661644 3:25072980-25073002 GAGCCACCGCGCCCGGCCGGAGG + Intergenic
952344693 3:32472527-32472549 GAGCCACCGCACCTGGCCGGAGG + Intronic
952593054 3:34980517-34980539 GAGCCACCGCACCCGGCCTCCGG - Intergenic
952798001 3:37260335-37260357 GAGCCACCACACCTGGCAGATGG - Intronic
952908682 3:38164428-38164450 GAGCCACCGCACCCGGCCTAAGG + Intergenic
953057962 3:39403398-39403420 GAGCCACTGCACCCGGCCTAGGG - Intergenic
953346707 3:42182085-42182107 GAGCCACTGCACCCGGCCAAGGG + Intronic
953924784 3:46977188-46977210 GAGCCACCGCGCCCGGCCCAGGG - Intronic
953954114 3:47217275-47217297 GAGCCACTGCACCCGGCAGTGGG + Intergenic
954063957 3:48091082-48091104 GAGCCACCGTGCCTGGCTGAAGG + Intergenic
954065891 3:48105805-48105827 GAGCCACCGCGCCCGGCCTAGGG - Intergenic
954187186 3:48926552-48926574 GAGCCACCGCACCCGGCCAATGG + Intronic
954220783 3:49152536-49152558 GAGCCACCACACCCGGCCAAAGG - Intergenic
954221907 3:49160118-49160140 GAGCCATTGCGCCCGGCTGATGG + Intergenic
954289264 3:49640782-49640804 GAGCCACCGCACCTGGCCAAAGG + Intronic
954350539 3:50039533-50039555 GGGCCACCGCACCCAGCATACGG + Intronic
954473346 3:50719066-50719088 GAGCCACTGCACCCGGCTGTGGG + Intronic
954620331 3:51991742-51991764 GAGCAACCGCACCCGGCCAATGG - Intergenic
954652132 3:52171635-52171657 GTGCCCCTGCACCCAGCAGAGGG + Intergenic
954751233 3:52814866-52814888 GAGCCACCGCACCCGGCCTCTGG + Intronic
954915823 3:54148079-54148101 GAGCCACTGCGCCCAGCTGATGG + Intronic
955244448 3:57211378-57211400 ATGCTACCACGCCCGGCTGAAGG - Intronic
955269750 3:57485681-57485703 GAGCCACCGCACCCGGCTGGAGG + Intronic
955281051 3:57595662-57595684 GAGCCACCGCGCCCGGCCGGAGG - Intronic
955363465 3:58292630-58292652 GAGCCACCGCACCCAGCTGGAGG - Intronic
955724035 3:61913501-61913523 GAGCCACCGCACCCGGCCGAGGG + Intronic
956466927 3:69528648-69528670 GAGCCACCGCACCCAGCCTATGG + Intronic
956661560 3:71603033-71603055 GAGCCACCGCACCCAGCCGTGGG - Intergenic
956837824 3:73110039-73110061 GAGCCACCGCACCCAGCCGAGGG + Intergenic
956850396 3:73223495-73223517 GAGCCACCGCACCTGGCCAAGGG - Intergenic
957227985 3:77473738-77473760 GAGCCACCGCGCCTGGCTGCAGG + Intronic
959072677 3:101717428-101717450 GAGCCACCGCGCCCGGCAAAAGG - Intergenic
960138443 3:114129056-114129078 GAGCCACCACACCCGGCCTAGGG - Intronic
960247465 3:115415098-115415120 GAGCCAACGCACCCGGCCAAAGG + Intergenic
960700140 3:120431253-120431275 GAGCCACCGCACCCGGCCTCTGG + Intronic
960914966 3:122685790-122685812 GAGCCACCGCACCCTGCTGGGGG + Intronic
960919484 3:122731925-122731947 GAGCCACCGCGCCCAGCTGAGGG + Intergenic
961242736 3:125426331-125426353 GAGCCACCGCACCCGGCCTTAGG - Intergenic
961300949 3:125921687-125921709 GAGCCACCGCACCTGGCCTAGGG + Intergenic
961955428 3:130797403-130797425 GAGCCACTGCACCCGGCTCATGG + Intergenic
962182968 3:133227475-133227497 GAGCCACCGCGCCCGGCCTAAGG + Intronic
962295139 3:134176764-134176786 GAGCCACCGCACCCAGCTGCAGG - Intronic
962365642 3:134777897-134777919 GAGCCACCGCGCCCGGCTTTAGG + Intronic
962395340 3:135010844-135010866 GAGCCACCGTGCCCGGCCGAGGG + Intronic
962721345 3:138178006-138178028 GAGCCACCGCACCCGGCGGAGGG - Intergenic
962875921 3:139536061-139536083 GGGCCACTGCTCCTGGCTGATGG + Intronic
963207494 3:142651609-142651631 GTGCCACTGTGCCCAGCTGATGG + Intronic
963460144 3:145601905-145601927 GAGCCACCACACCTGGCTGTTGG + Intergenic
963642380 3:147876664-147876686 GAGCCACCACACCTGGCTGAAGG - Intergenic
963864032 3:150340910-150340932 GAGCCACCGCGCCCGGCCGCAGG + Intergenic
963894604 3:150672311-150672333 GAGCCACCACACCCGGCCTATGG - Intronic
963942539 3:151109326-151109348 GAGCCACCGCACTGGGCCGAAGG + Intronic
963956707 3:151262009-151262031 GTGCCACTGCACTCAGCTGAAGG + Intronic
964014698 3:151930507-151930529 GAGCCACCGCACCTGGCCAAGGG + Intergenic
964309433 3:155376798-155376820 GAGCCACTGCACCCGGCCTAAGG + Intronic
964395653 3:156243190-156243212 GAGCCACCGCACCTGGCCGATGG + Intronic
965082310 3:164050253-164050275 GAGCCACCGCGCCCGGCCAAAGG - Intergenic
965265494 3:166537735-166537757 GAGCCACCGCGCCCGGCCGGCGG - Intergenic
965384823 3:168033319-168033341 GAGCCACCGCGCCCGGCCAATGG - Intronic
965780273 3:172278640-172278662 GAGCCACCACACCCGGCCAAAGG - Intronic
965967272 3:174508395-174508417 GTGCCACCGCACCCGGTCCCTGG + Intronic
966090751 3:176132924-176132946 GAGCCACCGCGCCCGGCCAAAGG - Intergenic
966493949 3:180558475-180558497 GAGCCACCGCACCCAGCCTATGG - Intergenic
966531498 3:180986564-180986586 GAGTCACCGCGCCCGGTTGAAGG + Intronic
966605801 3:181820504-181820526 GAGCCACCACGCCCGGCTCAGGG + Intergenic
966616863 3:181922795-181922817 GAGCCACCACGCCTGGCTGAAGG - Intergenic
966839124 3:184074485-184074507 GAGCCACCGTGCCCGGCTGATGG - Intergenic
967063965 3:185897757-185897779 ATGCCACCACACCCAGCTAATGG - Intergenic
967090179 3:186128285-186128307 GAGCCACTGTGCCCGGCTGATGG + Intronic
967111908 3:186301341-186301363 GAGCCACCGCACCCGTCACATGG - Intronic
967688822 3:192449461-192449483 GTTCCACAGCACCCTGCTGTCGG + Intronic
967777186 3:193396600-193396622 GAGCCACCGCACCCAGCTGCAGG + Intergenic
967788358 3:193521646-193521668 GAGCCATCGCACCTGGCTGGAGG - Intronic
967842955 3:194021594-194021616 GAGCCACCGCCCCCAGCTGCAGG + Intergenic
967918294 3:194595907-194595929 GAGCCACCGCACCCGGCTGATGG + Intronic
967944389 3:194791426-194791448 GAGCCACCGCGCCCGGCCTATGG + Intergenic
967965141 3:194954895-194954917 GAGCCACCTCGCCCGGCCGATGG - Intergenic
968013113 3:195300327-195300349 GAGCCACCGCACCCGGCCACAGG + Intronic
968130323 3:196189307-196189329 GAGCCACCGCACCCTGCCAAGGG - Intergenic
968158548 3:196404544-196404566 GAGCCACCGCGCCCGGCCAATGG + Intronic
968334492 3:197901420-197901442 GAGCCACCGCCCCCGGCCCAAGG + Intronic
968454658 4:691000-691022 GAGCCACCGCACCCGGCCCATGG - Intergenic
968482753 4:843718-843740 GAGCCACCGCACCCGGCCTTGGG - Intergenic
968499263 4:939294-939316 GAGCCACTGCACCCGGCCCAAGG - Intronic
968544019 4:1186586-1186608 GAGCCACTGCACCCAGCTGATGG + Intronic
968806413 4:2775902-2775924 GAGCCACCGCACCCGGCCCAGGG - Intergenic
969034745 4:4244189-4244211 GAGCCACTGCACCTGGCTGGAGG - Intronic
969347823 4:6580338-6580360 GAGCCACAGCAGGCGGCTGAGGG - Intronic
969535319 4:7753110-7753132 GAGCCACTGCACCCGGCCCAAGG - Intergenic
970115241 4:12687233-12687255 ATGCCACCACACCCGGCTAATGG - Intergenic
970128897 4:12844862-12844884 GAGCCACCGCGCCCGGCCTAGGG - Intergenic
970202670 4:13626062-13626084 GAGCCACCGCGCCCGGTCGAGGG - Intronic
970406457 4:15768778-15768800 GAGCCACCGCGCCCGGCCGATGG + Intergenic
970688074 4:18590673-18590695 GAGCCACCGCACCTGGCCAATGG + Intergenic
971046303 4:22808865-22808887 GAGCCACCGCACCTGGCCCAAGG + Intergenic
971421446 4:26477292-26477314 GAGCCACCGCACCTGGCCAAGGG - Intergenic
972111103 4:35560600-35560622 GAGCCACCACACCCGGCCTAAGG - Intergenic
972445422 4:39138995-39139017 GAGCCACCACGCCCAGCTGATGG - Intergenic
973182249 4:47283670-47283692 GAGCCACCGCACCCGGCCTCTGG + Intronic
973283860 4:48393086-48393108 GAGCCACTGCACCCGGCCAATGG - Intronic
973800205 4:54470337-54470359 ATGCCACCACACCCAGCTAAAGG - Intergenic
974890029 4:67870528-67870550 GGGCCACCGCGCCCGGCCGGAGG - Intronic
975191833 4:71472955-71472977 GTGCCACCTGACCCAGGTGAGGG + Exonic
975317890 4:72976700-72976722 GAGCCACCGCACCCAGCCGAGGG - Intergenic
975993333 4:80284148-80284170 GAGCCACCGCACCCGGCCGAAGG - Intronic
976229512 4:82826635-82826657 GAGCCACTGCACCCGGCTTCAGG + Intronic
976233230 4:82867915-82867937 GAGCCACCGCACCCGGCCTAGGG + Intronic
976307481 4:83575158-83575180 GAGCCACCGCGCCCGGCCAACGG + Intronic
976416691 4:84784551-84784573 GAGCCATCCCACCCGGCTCAAGG - Intronic
976492531 4:85688095-85688117 GAGCCACCGCACCTGGCCGGTGG + Intronic
976596514 4:86900315-86900337 GAGCCACCGCACCTGGCAGTAGG + Intronic
976616590 4:87084252-87084274 GAGCCACCGCACCCAGCCAATGG - Intronic
977172800 4:93783786-93783808 GAGCCACCGCGCCCGGCCAAGGG - Intergenic
977295186 4:95201886-95201908 GAGCCACCACACCCGGCCGAGGG + Intronic
977693214 4:99939075-99939097 GAGCCACTGTACCCGGCTGGTGG - Intronic
978009496 4:103662502-103662524 GAGCCACCGCCCCAGCCTGATGG + Intronic
978122524 4:105097698-105097720 GAGCCACTGCTCCCGGCCGAGGG - Intergenic
978137745 4:105282881-105282903 GAGCCACCGCGCCCGGCCAAGGG - Intergenic
978446319 4:108783488-108783510 GAGCCACCGCACCCGGCCTTTGG + Intergenic
978494827 4:109347672-109347694 GAGCCACCGCGCCTGGCCGAGGG - Intergenic
978660275 4:111118292-111118314 CTGCCACCATGCCCGGCTGATGG - Intergenic
978662037 4:111138122-111138144 GAGCCACCGCGCCCGGCCGGAGG - Intergenic
978697337 4:111597718-111597740 GAGCCACCGCGCCTGGCCGAGGG + Intergenic
978929948 4:114297928-114297950 GAGCCACTGCACCTGGCCGAAGG - Intergenic
978993890 4:115125455-115125477 GAGCCACCGCACCTGGCCAAGGG - Intergenic
979866038 4:125754768-125754790 GAGCCACCGCGCCCGGCTTCTGG + Intergenic
979949326 4:126873303-126873325 GAGCCACCACACCCGGCTTATGG + Intergenic
980050838 4:128038604-128038626 GAGCCACTGCACCCGGCCTAGGG - Intronic
980053333 4:128059014-128059036 GAGCCACCTCGCCTGGCTGATGG + Intergenic
980057861 4:128096275-128096297 GAGCCACCGCGCCCGGCCTATGG + Intronic
980436169 4:132777168-132777190 GAGCCACCGCACCTGGCCAAAGG - Intergenic
980502563 4:133674710-133674732 GAGCCACCGCACCCGGCCTGGGG + Intergenic
980937008 4:139235164-139235186 GAGCCACCGCACCCGGCCTGAGG + Intergenic
980989276 4:139725041-139725063 GAGCCACCGCACCCGGCCAAGGG + Intronic
981009351 4:139909558-139909580 GGGCCACCGCACCTGGTTTAAGG - Intronic
981077917 4:140609032-140609054 GAGCCACCGCACCCAGCCAAGGG - Intergenic
981148680 4:141355466-141355488 GAGCCACAGCACCTGGCTGGCGG + Intergenic
981473512 4:145163990-145164012 GAGCCACCGCACCCGGCTATAGG + Intronic
981718429 4:147775195-147775217 GAGCCACCGCACCGGCCTGATGG + Intronic
982254134 4:153435770-153435792 GTGCCACTGCACCCAGTTTAGGG + Intergenic
982855649 4:160379108-160379130 GAGCCACCGCGCCCGGCCAAGGG + Intergenic
983011797 4:162556422-162556444 GAGCCACCACACCCAGCTGAAGG + Intergenic
983039784 4:162912011-162912033 GAGCCACTGCACCTGGCTGAAGG - Intergenic
983390551 4:167125427-167125449 GAGCCACCGCGCCCGGCCGGGGG - Intronic
983520365 4:168702264-168702286 GAGCCACTACACCCAGCTGATGG - Intronic
983557184 4:169069061-169069083 GAGCCACCGCACCCGGCCTGAGG - Intergenic
983639200 4:169928821-169928843 GAGCCACCGCACCCGGCCGATGG + Intergenic
984002597 4:174268718-174268740 GAGCCACCGCGCCCGGCCGGGGG + Intronic
984082074 4:175259944-175259966 GAGCCACTGTGCCCGGCTGAGGG + Intergenic
984292901 4:177817831-177817853 GAGCCACTGCACCCGGCTGTAGG + Intronic
984611434 4:181844000-181844022 GAGCCACCGCGCCCGGCCGAGGG + Intergenic
984969870 4:185178527-185178549 GAGCCACTGCACCAGGCTGAAGG + Intronic
985069365 4:186152826-186152848 GAGCCACCGCGCCCGGCCAAAGG + Intronic
985102930 4:186475906-186475928 GAGCCACCGCGCCCGGCCTAGGG + Intronic
985197583 4:187448816-187448838 GAGCCACCGCGCCCGGCCAAAGG - Intergenic
985447382 4:190032096-190032118 GAGCCACCACACCGGGCAGATGG - Intergenic
986158910 5:5206140-5206162 GAGCCACCGCGCCCGGCCAAAGG - Intronic
986347287 5:6846722-6846744 GAGCCACCGCGCCCGGCGCAGGG + Intergenic
986680904 5:10232051-10232073 GTGCCACCATGTCCGGCTGATGG - Intronic
987032613 5:13989765-13989787 GAGCCACCACACCCAGCCGAGGG + Intergenic
987179703 5:15354744-15354766 AAGCCATTGCACCCGGCTGATGG + Intergenic
987195224 5:15519057-15519079 GAGCCACCGCGCCCTGCTGCAGG - Intronic
987567577 5:19612854-19612876 GAGCCACCGCATCCGGCCGAGGG - Intronic
987725909 5:21699409-21699431 GAGCCACTGCACCCGGCCAAAGG + Intergenic
987852523 5:23374729-23374751 GAGCCACCGCGCCCGGCCTATGG + Intergenic
988276050 5:29081982-29082004 GAGCCACTGCACCCGGCCAAGGG - Intergenic
988536734 5:32075094-32075116 GAGCCACCGCACCCAGCCTAGGG + Intronic
988802361 5:34708484-34708506 GAGCCACCGCACCTGGCCAAAGG + Intronic
988837304 5:35046049-35046071 GAGCCACCGCACCCGGCCAGTGG + Intronic
988959137 5:36351500-36351522 AAGCCACTGCACCCGGCTGAGGG + Intergenic
988980501 5:36563557-36563579 AAGCCACCGCACCCGGCTCTTGG + Intergenic
989185807 5:38624741-38624763 GAGCCACCGCGCCCGGCGGCTGG + Intergenic
989652435 5:43708407-43708429 GAGCCACCGCGCCCGGCCCATGG - Intergenic
990265350 5:54069957-54069979 GAGCCACCACACCTGGCTGGAGG + Intronic
990319129 5:54612545-54612567 GAGCCACCGTGCCTGGCTGAGGG + Intergenic
990377273 5:55184315-55184337 GAGCCACTGCACCCAGCTGGTGG - Intergenic
990414502 5:55573155-55573177 GAGCCACTGCACCCAGCCGATGG + Intergenic
991691335 5:69227822-69227844 GTGCCACTGCACCCAGCTAAGGG - Intronic
991696233 5:69275687-69275709 GAGCCACCGCGCCTGGCTGAAGG - Intronic
991911959 5:71571430-71571452 GTGCCACCGCACCTGGCCCCTGG + Intergenic
992252158 5:74886353-74886375 GAGCCACCGCGCCCGGCCAATGG - Intergenic
992331157 5:75718292-75718314 GAGCCACCACGCCCGGCCGAAGG + Intergenic
992490643 5:77240435-77240457 GAGCCACCGCGCCCGGCCAAGGG + Intronic
992661030 5:78960845-78960867 GGGCCAGTGCACCCGGCTGACGG + Intronic
993226939 5:85179254-85179276 GAGCCACTGCACCCGGCTGGTGG + Intergenic
993469638 5:88291421-88291443 GAGCCACTGCACCCGGCCCAGGG - Intergenic
994006517 5:94844016-94844038 GAGCCACCGCACCCGGCCAAGGG - Intronic
994024096 5:95061717-95061739 GAGCCACCGCGCCCGGCCAAGGG + Intronic
994029028 5:95119886-95119908 GAGCCACCGCGCCCGGCTGCTGG - Intronic
994199049 5:96951540-96951562 GAGCCACCGCACCTGGCGGGGGG + Intronic
994705753 5:103204592-103204614 GTGCCACCACACCCAGCTCATGG + Intronic
994965432 5:106663949-106663971 GAGCCACCGCGCCCGGCCAATGG + Intergenic
994976840 5:106818927-106818949 GAGCCACCGCACCTGGCTGATGG - Intergenic
995005755 5:107193568-107193590 GAGCCACCGCGCCCGGCCTAGGG + Intergenic
995098700 5:108272004-108272026 GAGCCACTGCACCCGGCCGTTGG - Intronic
995140674 5:108732058-108732080 GAGCCACCACACGCGGCCGAAGG + Intergenic
995385722 5:111586591-111586613 GAGCCACTGCGCCCGGCTGATGG - Intergenic
995531717 5:113097805-113097827 GAGCCACCGCACCTGGCCGAGGG + Intronic
995884201 5:116875549-116875571 GAGCCACCGTGCCCGGCTGGTGG + Intergenic
996062199 5:119044825-119044847 GAGCCACCGCGCCCAGCCGAAGG + Intronic
996276001 5:121666708-121666730 GAGCCACCGCGCCCGGCCCAAGG - Intergenic
996422494 5:123277962-123277984 GAGCCACCGCGCCCGGCCGGGGG + Intergenic
996718704 5:126609383-126609405 GAGCCACTGCACCCGGCCAAAGG + Intronic
996772501 5:127099714-127099736 GAGCCACCGCGCCCGGCTACGGG + Intergenic
996774980 5:127122995-127123017 GAGCCACCGCACCCGGCCTAGGG + Intergenic
996965795 5:129306178-129306200 GAGCCACCGCACCCGGCCTGTGG + Intergenic
997100730 5:130966104-130966126 GTACCACCACACCCAGCTAATGG + Intergenic
997118848 5:131154076-131154098 GAGCCACCGCGCCCGGCCCAGGG - Intergenic
997132721 5:131293285-131293307 GAGCCACCGTGCCCGGCTGAGGG - Intronic
997303379 5:132822645-132822667 GAGCCACCGCGCCCGGCTGGAGG + Exonic
997332214 5:133072536-133072558 GTGCCACCACACCCAGCTAGTGG + Intronic
997461899 5:134058597-134058619 GAGCCACCGCACCCGGCCCAAGG + Intergenic
997478324 5:134162669-134162691 GAGCCACTGCACCCAGCTAAGGG + Intronic
997524443 5:134543386-134543408 GAGCCACCGCACCGGGCCTATGG - Intronic
997529130 5:134571412-134571434 GAGCCACCGCGCCCGGCCCAGGG - Intronic
997724891 5:136112332-136112354 GAGCCACCACACCCGGCCAAGGG + Intergenic
997985134 5:138495274-138495296 GAGCCACGGCACCCGGCCCATGG + Intergenic
998017212 5:138741979-138742001 GAGCCACCGCGCCCGACTGAGGG - Intronic
998023286 5:138789738-138789760 GAGCCACCGCACCCGGCTGCAGG + Intronic
998336579 5:141376969-141376991 GAGCCACCGCGCCCGGCCGAGGG + Intronic
998428124 5:142047206-142047228 GAGCCACTGCACCTGGCCGATGG - Intergenic
998472555 5:142394392-142394414 GAGCCACCGCGCCCGGCCAAAGG + Intergenic
998512099 5:142722078-142722100 GAGCCACCGCACCTGGCCAATGG + Intergenic
998779437 5:145640200-145640222 GAGCCACCGCGCCCGGCCGCCGG - Intronic
999136839 5:149326252-149326274 GAGCCATCACGCCCGGCTGAGGG - Intronic
999296858 5:150465054-150465076 GAGCCACCGCACCCAGCTCTGGG - Intergenic
999710242 5:154311894-154311916 GAGCCACCGTACCCGGTGGAGGG + Intronic
999762960 5:154716731-154716753 GAGCCACTGCACCCAGCTGATGG + Intronic
999929300 5:156413079-156413101 GAGCCACCGCGCCCGGCCGCAGG + Intronic
1000169602 5:158689240-158689262 GAGCCACCACACCCTGCTGGGGG - Intergenic
1000347002 5:160322621-160322643 GAGCCACCGCGCCCAGCCGAGGG - Intronic
1000366206 5:160493634-160493656 GAGCCACCACACTCGGCTGGTGG + Intergenic
1000608912 5:163354338-163354360 GAGCCACCGCACCCGGCCTAGGG + Intergenic
1000812511 5:165880416-165880438 GAGCCACCGCGCCCGGCCTAAGG - Intergenic
1001021085 5:168183112-168183134 GAGCCACCGCCCCCGGCCCAGGG + Intronic
1001147289 5:169195808-169195830 GAGTCACCGTGCCCGGCTGAGGG + Intronic
1001471707 5:172018612-172018634 GAGCCACCGCACCCAGCTGAGGG - Intergenic
1001490238 5:172149759-172149781 GAGCCACCGCGCCCGGCCCAAGG - Intronic
1001511511 5:172326069-172326091 GAGCCACCGCGCCTGGCTGGCGG + Intronic
1001608778 5:172983425-172983447 GAGCCACCGCACCCGGCCTGGGG + Intergenic
1001794011 5:174486711-174486733 GAGCCACCGCACCCGGCTGAAGG - Intergenic
1002025855 5:176395848-176395870 GAGCCACCACACCCAGCTGAAGG - Intronic
1002113388 5:176937210-176937232 GAGCCACCGCACCTGGCCGAGGG - Intronic
1002165579 5:177342967-177342989 GAGCCACCGCGCCCGGCCTAGGG - Intronic
1002284709 5:178154434-178154456 GAGCCACCGCGCCCGGCCTAAGG + Intergenic
1002296863 5:178236327-178236349 GAGCCACCGCGCCCGGCCCATGG + Intergenic
1002384728 5:178857840-178857862 GAGCCACCACACCCGACTGGAGG + Intergenic
1002494243 5:179600978-179601000 GAGCCACTGCGCCCAGCTGAGGG + Intronic
1002517233 5:179768170-179768192 GAGCCACTGCACCCGGCCTAGGG - Intronic
1002530459 5:179841411-179841433 GAGCCACTGTACCCGGATGAAGG + Intronic
1002602357 5:180361348-180361370 GAGCCACCGCACCCGGCTGTGGG + Intergenic
1003088308 6:3079360-3079382 GAGCCACCGTTCCCAGCTGATGG + Intronic
1003378586 6:5602363-5602385 GAGCCACTGCACCCGGCTGGAGG - Intronic
1003654787 6:7996622-7996644 GTGCCACCACACACGGCTGCTGG - Intronic
1003672209 6:8170076-8170098 GAGCCACCGCGCCCAGCAGAGGG + Intergenic
1003859202 6:10306766-10306788 GAGCCACCGCACCCGGCCCTGGG - Intergenic
1003910430 6:10739096-10739118 GAGCCACCGCGCCCGGCCAATGG + Intergenic
1004048570 6:12050299-12050321 GAGCCAGCGCACCCGGCCGATGG - Intronic
1004207213 6:13602991-13603013 GAGCCACCGCACCCGGCCTGTGG - Intronic
1004224183 6:13771263-13771285 GAGCCACCTCACCTGGCCGATGG - Intergenic
1004397873 6:15262062-15262084 GAGCCACCGCGCCCGGCCCAGGG + Intronic
1004661816 6:17717453-17717475 GAGCCACCGCGTCCGGCCGAAGG - Intergenic
1004841951 6:19597633-19597655 GAGCCACCGCACCCAGCTTCTGG + Intergenic
1005346449 6:24895331-24895353 GAGCCACCGCACCCGGCACCTGG + Intronic
1005474129 6:26190818-26190840 GAGCCACTGCACCCGGCTTTAGG - Intergenic
1005578273 6:27210290-27210312 GAGCCACCGCGCCCGACTGAGGG - Intergenic
1005722871 6:28620018-28620040 GAGCCACTGCACCCAGCCGAAGG - Intergenic
1006142404 6:31937853-31937875 CTGCCACCACACCCAGCTAATGG - Intronic
1006172272 6:32100441-32100463 GAGCCACTGCACCCGGCCTATGG - Intronic
1006406231 6:33847316-33847338 GAGCCACCGCGCCCGGCCCAGGG - Intergenic
1006643879 6:35503220-35503242 GAGCCACCGCGCCCGGCCCAGGG + Intronic
1006716608 6:36124463-36124485 GAGCCACCGCACCTGGCTGATGG + Intergenic
1006780019 6:36626292-36626314 GAGCCACCGCCCCCGGCTCCAGG + Intergenic
1006854842 6:37125629-37125651 GAGCCACCGCGCCGGGCCGACGG + Intergenic
1006878954 6:37322365-37322387 GTGCCATCACACCTGGCTGACGG - Intronic
1006940034 6:37745812-37745834 GAGCCACCGTACCCGGCTTGTGG + Intergenic
1006947744 6:37796678-37796700 GAGCCACCGTACCCGGCCTAGGG - Intergenic
1007024479 6:38556730-38556752 GATCCACCGCGCCCGGCCGAAGG - Intronic
1007279920 6:40704040-40704062 GAGCCACTGCGCCCGGCCGAGGG - Intergenic
1007427553 6:41757216-41757238 GAGCCACCGTGCCCGGCCGAGGG + Intergenic
1007606725 6:43122889-43122911 GAGCCACCGCACCCGGCCAAAGG + Intronic
1007761850 6:44137982-44138004 GAGCCACCGCACCTGGCCGGAGG + Intronic
1007810973 6:44485460-44485482 GAGCCACTGCACCCGGCCCAGGG + Intergenic
1008028411 6:46665399-46665421 GAGCCACCGCACCCGGCGGAGGG - Intronic
1008087967 6:47264241-47264263 GAGCCACCGCACCCGGCCTAAGG - Intronic
1008129504 6:47704313-47704335 GAGCCACTGCACCCGGCAGCAGG + Intronic
1008648022 6:53535096-53535118 GTGCCACCTCACCTGGCTAATGG - Intronic
1008928032 6:56907918-56907940 GTGCCACCACGCCCGGCTGGTGG - Intronic
1008950564 6:57153695-57153717 GAGCCACTGCACCCAGCTGAAGG + Intronic
1009566540 6:65318149-65318171 GAGCCACCGCGCCCGGCTGGAGG + Intronic
1010203287 6:73300930-73300952 GAGCCACCGCGCCCAGCCGAAGG - Intronic
1010224460 6:73476076-73476098 GAGCCACCACGCCCAGCTGAGGG - Intronic
1010337592 6:74704973-74704995 GAGCCACCGCGCCCGGCCCAGGG + Intergenic
1010394191 6:75372076-75372098 GTGCCACTGCACCCGGCCTCTGG - Intronic
1011489351 6:87874708-87874730 GAGCCACCACACCCAGCTTAAGG - Intergenic
1012466183 6:99518725-99518747 GAGCCACCACGCCCGGCAGAAGG - Intronic
1012482581 6:99684001-99684023 GAGCCACCGCGCCCAGCCGAGGG - Intergenic
1012559016 6:100555844-100555866 GTGCCACCACACCCAGCTATTGG - Intronic
1012901530 6:105012181-105012203 GAGCCACCGCACCCAGCCCAAGG - Intronic
1013040221 6:106425779-106425801 GTGCCACCACACCTGGCTACTGG + Intergenic
1013040774 6:106431144-106431166 GAGCCACCACACCCGGCGTAGGG + Intergenic
1013355816 6:109345155-109345177 GAGCCACCGCACCCGGCCCCTGG + Intergenic
1013509927 6:110835300-110835322 GAGCCACCGCACCCGGCCTGTGG + Intronic
1013550391 6:111202189-111202211 GAGCCACCACACCCGGCCGTGGG - Intronic
1013965760 6:115953471-115953493 GAGCCACCGCGCCCGGCCCAAGG + Intronic
1014116925 6:117676292-117676314 GAGCCACCGCGCCCGGCCAAGGG - Intronic
1014197730 6:118578445-118578467 GAGCCACCGCTCCCGGCCAAAGG - Intronic
1014222482 6:118811749-118811771 GAGCCACCGCACCCGGCCAAAGG + Intergenic
1014450473 6:121576171-121576193 GAGCCACCACACCCAGCTGAGGG - Intergenic
1014622952 6:123691762-123691784 GAGCCACCGCACCCGGCCACTGG + Intergenic
1014655898 6:124103801-124103823 GAGCCACCGCACCCGGCCCCAGG - Intronic
1015401645 6:132794710-132794732 GAGCCACCGCACCTGGCCTAAGG - Intronic
1015618785 6:135107402-135107424 GAGCCACCGCACCTGGCCCAAGG + Intergenic
1015758949 6:136636656-136636678 GAGCCACCGCACCCGACTGCTGG - Intronic
1016003533 6:139066811-139066833 GAGTCACCGCGCCCGGCAGAAGG + Intergenic
1016038668 6:139409608-139409630 GAGACACCGCGCCCGGCCGATGG - Intergenic
1016082806 6:139876939-139876961 GAGCCACCGCGCCCGGCCAAGGG - Intergenic
1016245687 6:141977678-141977700 GAGCCACCGCGCCCGGCCCAAGG + Intergenic
1016810203 6:148253586-148253608 CAGCCACCGCACCCGGCCAATGG - Intergenic
1016923428 6:149317771-149317793 CCGCCACCGCTCCTGGCTGAGGG - Intronic
1016946066 6:149535070-149535092 GAGCCACTGCACCCAGCTGGAGG - Intronic
1016976502 6:149814184-149814206 GAGCCACCACACCCGGTCGAGGG + Intergenic
1017126162 6:151066479-151066501 GAGCCACCGCACCCGGCTAAAGG - Intronic
1017228600 6:152048084-152048106 GAGCCACCGCGCCAGGCCGAGGG - Intronic
1017279366 6:152606936-152606958 GAGCCACCGCGCCCGGCAAAAGG + Intronic
1017438796 6:154443180-154443202 GAGCCACCGCGCCTGGCCGACGG + Intronic
1017590572 6:155974534-155974556 GAGCCACCGCACCGGGCCGGGGG + Intergenic
1018074301 6:160197379-160197401 GAGCCACCGCACCTGGCCGAGGG + Intronic
1018484537 6:164227741-164227763 GAGCCACTGCACCCGGCCCATGG + Intergenic
1018632317 6:165831767-165831789 GAGCCACTGCACCCGGCCGCAGG + Intronic
1018890829 6:167980358-167980380 GAGCCACCGCGCCCAGCCGAGGG - Intergenic
1019381525 7:726751-726773 GCGGCCCCACACCCGGCTGAGGG + Exonic
1019502539 7:1371596-1371618 GAGCCACCGCACCCGGCCATTGG - Intergenic
1019511650 7:1420590-1420612 GAGCCACCGCACCCGGCTCATGG - Intergenic
1019522061 7:1465570-1465592 GAGCCACCGCACCCGGCCTCAGG + Intergenic
1019545243 7:1571017-1571039 GAGCCACCGCGCCCCGCTGCTGG + Intergenic
1019580726 7:1760727-1760749 GAGCCACCGCACCCGGCCCTCGG - Intergenic
1019659953 7:2218621-2218643 GAGCCGCCGTACCCTGCTGAGGG - Intronic
1019683770 7:2368432-2368454 GAGCCACCGCGCCCGGCCTAAGG + Intronic
1019767536 7:2862919-2862941 GCGCCACCGCACCCGGCCCTTGG + Intergenic
1019988738 7:4677703-4677725 GCGCCACCGCGCCCGGCCGTCGG + Intergenic
1020049881 7:5074326-5074348 GTGCCACCGCGCCCAGCAGGTGG + Intergenic
1020094114 7:5358527-5358549 GAGCCACTGCACCCAGCTGAGGG - Intronic
1020190515 7:5993576-5993598 GAGCCACCGCGCCCGGCCCATGG - Intronic
1020198428 7:6060122-6060144 GAGCCACAGCGCCCGGCTTAGGG - Intergenic
1020232759 7:6332531-6332553 GAGCCACCACGCCTGGCTGAGGG - Intronic
1020267858 7:6573357-6573379 GAGCCACCGCACCCGGCCCTGGG + Intergenic
1020270480 7:6591885-6591907 GAGCCACCGCACCCGGCCGAGGG - Intronic
1020344241 7:7145798-7145820 GAGCCACCGCACCTGGCTGCAGG - Intergenic
1020913952 7:14169073-14169095 GAGCCACTGCACCCGGCCCATGG - Intronic
1021221129 7:17976357-17976379 GAGCCACCGCACCCGGCCAATGG + Intergenic
1021551531 7:21876165-21876187 GAGCCACCGCACCTGGCCCAAGG + Intronic
1021702536 7:23334049-23334071 GAACCACAGCACCCGGCTCATGG - Intronic
1022009439 7:26295983-26296005 GCGCCACCACACCCGGCCCAGGG - Intronic
1022049455 7:26651464-26651486 GAGCCACCGCGCCCAGCTGGGGG - Intergenic
1022252523 7:28622734-28622756 GAGCCACCACACCCAGCTGGTGG - Intronic
1022456184 7:30560256-30560278 GAGCCACCACACCCGGCCCAGGG + Intergenic
1022540709 7:31133179-31133201 AAGCCACGGCGCCCGGCTGATGG - Intergenic
1023305453 7:38821416-38821438 GAGCCACCGTACGTGGCTGATGG - Intronic
1023435807 7:40139480-40139502 GAGCCACTGTGCCCGGCTGATGG + Intronic
1023482363 7:40647564-40647586 GAGCCACTGCGCCTGGCTGAGGG - Intronic
1023820091 7:43975808-43975830 GAGCCACTGCACCCGGCCCAAGG + Intergenic
1023821696 7:43984215-43984237 GAGCCACCGCAACCGGCTTTGGG + Intergenic
1023973407 7:45008644-45008666 GAGCCACCGCACCCGGCCAAGGG + Intronic
1024101434 7:46036431-46036453 GAGCCACCGCACCTGGCCAAGGG + Intergenic
1024277529 7:47690604-47690626 GTGCCACCACGCCCGGCCCAAGG - Intergenic
1024485374 7:49911610-49911632 GAGCCACTGCACCCGGCCAATGG - Intronic
1024584516 7:50830146-50830168 GAGCCACTGCACCCGGCCCAAGG + Intergenic
1025066862 7:55864524-55864546 GAGCCACCGTGCCCGGCTGAAGG - Intergenic
1025799763 7:64774808-64774830 GAGCCACCGCACCCAGCCAAAGG - Intergenic
1025807463 7:64848986-64849008 GAGCCACCACACCTGGCTGGGGG + Intergenic
1025935360 7:66031610-66031632 GAGCCACAGCGCCCGGCAGATGG - Intergenic
1026026174 7:66745480-66745502 GAGCCACCGCACCCAGCCTATGG - Intronic
1026091650 7:67305245-67305267 GTGCCACCACGCCTGGCTAATGG - Intergenic
1026097389 7:67357273-67357295 GAGCCACCGCGCCCGGCCAAGGG + Intergenic
1026127480 7:67591953-67591975 GAGCCACCGCGCCCGGCCCATGG + Intergenic
1026128203 7:67597989-67598011 GAGCCACCGCACCCGGCCATGGG + Intergenic
1026279131 7:68906049-68906071 GAGCCACCGCACCCAGCCCAAGG + Intergenic
1026498634 7:70924272-70924294 GAGCCACCGCGCCCGGCCAATGG + Intergenic
1026586276 7:71658601-71658623 GAGCCACCGCACCTGGCCGAGGG - Intronic
1026594239 7:71721039-71721061 GAGCCACTGCACCTGGCCGAGGG - Intergenic
1026740898 7:72977695-72977717 GAGCCACTGCACTCGGCAGAAGG - Intergenic
1026770832 7:73197491-73197513 GAGCCACCGCGCCCGGCCAATGG + Intergenic
1026782531 7:73279140-73279162 GAGCCACCGAGCCCGGCAGAAGG + Intergenic
1026798205 7:73379188-73379210 GAGCCACCGCACCCGGCAGAAGG - Intergenic
1026928365 7:74209294-74209316 GAGCCACCGCGCCCGGCCCATGG + Intronic
1026933643 7:74239144-74239166 GAGCCACCGCACCGGGCCAAGGG + Intronic
1026963216 7:74423037-74423059 GAGCCACTGCAGCTGGCTGAGGG + Intergenic
1027011700 7:74750888-74750910 GAGCCACCGCGCCCGGCCAATGG + Intronic
1027023294 7:74831965-74831987 GAGCCACCGAGCCCGGCAGAAGG + Intronic
1027064636 7:75113339-75113361 GAGCCACCGAGCCCGGCAGAAGG - Intronic
1027076340 7:75195163-75195185 GAGCCACCGCGCCCGGCCAATGG - Intergenic
1027102835 7:75387379-75387401 GAGCCACTGCACTCGGCAGAAGG + Intergenic
1027195939 7:76030281-76030303 GTGCCACCACACCCAGCCCAGGG + Intronic
1027664022 7:81022011-81022033 GAGCCACCACGCCCGGCTAATGG + Intergenic
1028809043 7:95062670-95062692 GAGCCACCGCACCCGGCCAAGGG + Intronic
1029009043 7:97239675-97239697 GAGCCACTGCACCTGGCAGATGG - Intergenic
1029027553 7:97433112-97433134 GAGCCACCACGCCCGGCCGAAGG + Intergenic
1029140403 7:98405676-98405698 GAGCCACCGCGCCCGGCAGTAGG + Intergenic
1029147561 7:98457768-98457790 GAGCCACCGCACCCAGCCTAAGG + Intergenic
1029209499 7:98894761-98894783 ATGCCACCACACCCAGCTAATGG + Intronic
1029290165 7:99496338-99496360 GAGCCACCACACCCGGCACAAGG + Intronic
1029303009 7:99599257-99599279 GAGCCACCGCACCCGGCCCATGG + Intronic
1029333274 7:99878184-99878206 GAACCACCGCACCCGGCCGCTGG + Intronic
1029512974 7:101008379-101008401 GAGCCACAGCACCCGGCCCAGGG + Intronic
1029680593 7:102106370-102106392 GAGCCACCGCACCCGGCTCTTGG + Intronic
1029698909 7:102233464-102233486 CGGCCACCGCACCAGGCTGAAGG + Intronic
1029749958 7:102537634-102537656 GAGCCACCGCAACCGGCTTTGGG + Intergenic
1029767908 7:102636740-102636762 GAGCCACCGCAACCGGCTTTGGG + Intronic
1029885013 7:103859575-103859597 GAGCCACGGCACCCGGCCAAAGG + Intronic
1029918230 7:104234499-104234521 GAGCCACCGCACCCGGCCTGAGG - Intergenic
1029960312 7:104683272-104683294 GAGCCACCGCACCCGGCCACTGG + Intronic
1029968401 7:104764453-104764475 GAGCCACCGCACCCAGCCAATGG + Intronic
1030040895 7:105448999-105449021 GAGCCACTGCGCCCAGCTGAGGG - Intronic
1030241456 7:107330970-107330992 GTGCCACCACACCCAGCTAATGG + Intronic
1030290348 7:107865879-107865901 GAGCCACTGCACCCGGCCTAGGG + Intergenic
1030859639 7:114608912-114608934 GAGCCACCGCACCCAGCTGAAGG - Intronic
1030884417 7:114921211-114921233 GAGCCACCGCTCCCGGCCGAAGG + Intergenic
1031491919 7:122399956-122399978 GAGCCACCGCGCCCGGCCAAGGG + Intronic
1032149867 7:129419269-129419291 GAGCCACCACACCTGGCTGCAGG - Intronic
1032259677 7:130325036-130325058 GAGCCACCACACCCGGCCAAGGG + Intergenic
1032399421 7:131613456-131613478 GAGCCACCGCGCCCGGCCGAAGG - Intergenic
1032680982 7:134183038-134183060 GAGCCATCGCGCCCGGCTGCGGG + Intronic
1032932488 7:136689702-136689724 GAGCCACCGCGCCTGGCCGAGGG + Intergenic
1032936174 7:136734342-136734364 GAGCCACCGTACCCGGCCCAAGG - Intergenic
1033077932 7:138267208-138267230 GAGCCACCACACCCAGCAGATGG - Intergenic
1033094520 7:138418915-138418937 GAGCCACCGCACCCGGCCTGTGG - Intergenic
1033103413 7:138497350-138497372 GAGCCACCGCGCCTGGCCGATGG + Intronic
1033160885 7:138995615-138995637 ATGCTACCGCACCCGGTTGGAGG + Intergenic
1033204294 7:139404223-139404245 GAGCCACCACGCCCGGCCGAAGG - Intronic
1033219214 7:139516909-139516931 GAGCCACCGCACCTGGCAGAGGG - Intergenic
1033219489 7:139518924-139518946 GAGCCACCGCGCCCGGCCTAGGG + Intergenic
1033237025 7:139646209-139646231 GAGCCACCGCACCAGCCTTAAGG - Intronic
1033318374 7:140317201-140317223 GAGCCACCGCGCCTGGCTGGTGG - Intronic
1033341815 7:140498018-140498040 GAGCCACCGCGCCCGGCCTAAGG + Intergenic
1033641718 7:143268206-143268228 GAGCCACTGCACCTGGCTCAGGG - Intronic
1033862099 7:145640955-145640977 GAGCCACCGCGCCCGGCCAAAGG + Intergenic
1033907053 7:146218223-146218245 GAGCCACCGCGCCCGGCCGATGG - Intronic
1034118329 7:148604409-148604431 GAGCCACCACACCCGGCCTAGGG + Intronic
1034195368 7:149242306-149242328 GAGCCACCGCACCCGGCCTAAGG + Intronic
1034219782 7:149434870-149434892 GAGCCACCGCTCCTGGCCGAAGG + Intronic
1034254766 7:149718797-149718819 GAGCCACCACACCCAGCCGAAGG + Intronic
1034514253 7:151561960-151561982 GAGCCACCGCACCCGGCTCCAGG - Intronic
1034630508 7:152526913-152526935 GAGCCACCACATCCAGCTGATGG - Intergenic
1034902971 7:154919132-154919154 GAGCCACCGCACCCGGCCAAAGG - Intergenic
1034921811 7:155089360-155089382 GAGCCACCGTGCCCTGCTGAAGG + Intergenic
1035584704 8:762959-762981 GAGCCACTGCGCCCAGCTGACGG + Intergenic
1035615699 8:999761-999783 GAGTCACTGCACCCGGCTGGTGG + Intergenic
1035751059 8:1996550-1996572 GAGCCACCGCGCCTGGCTGAAGG + Intronic
1035852969 8:2939983-2940005 GTGCAGCTGCACCCGGCAGAAGG + Intronic
1035934505 8:3821496-3821518 GAGCCACCGCACCCAGCTCCTGG - Intronic
1035986516 8:4438482-4438504 GTTCCACAGCACCTGGCTGTAGG + Intronic
1036149935 8:6287853-6287875 GAGCCACCGCACCCGGCCCATGG - Intergenic
1036237670 8:7054938-7054960 GTGCCACCACACCCTACTAATGG - Intergenic
1036341151 8:7916632-7916654 GAGCCACCGCGCCCGGCCTATGG + Intergenic
1036931582 8:12961415-12961437 GAGCCACCGCGCCCGGCCGAAGG - Intronic
1037102649 8:15066022-15066044 GAGCCACCGCGCCCGGCCCAAGG - Intronic
1037516024 8:19633059-19633081 GAGCCACCGTGCCCAGCTGAGGG + Intronic
1037706216 8:21317290-21317312 GAGCCACCGCACCTGGCCAAAGG + Intergenic
1038278836 8:26144155-26144177 GAGCCACTGCACCCGGCCTATGG + Intergenic
1038481777 8:27906952-27906974 GAGTCACCACACCTGGCTGAGGG + Intronic
1038544870 8:28418057-28418079 GAGCCACCGCACCCGGCTACAGG - Intronic
1039203982 8:35129098-35129120 GAGCCACTGCACCCGGCCCAGGG - Intergenic
1039361736 8:36884449-36884471 GAGCCACCGCGCCCGGCTACTGG - Intronic
1039446301 8:37635905-37635927 GTCCCACAGAACCCGGATGAAGG - Intergenic
1039462399 8:37755903-37755925 GAGCCACCGCGCCCGGCCAAGGG - Exonic
1039809628 8:41034922-41034944 GTGCCACCACATCTGGCTAACGG + Intergenic
1040036742 8:42877462-42877484 GAGCCACCGCACCCAGCCTATGG + Intronic
1040350081 8:46556905-46556927 GAGCCACCGCACCTGGCCTAAGG - Intergenic
1040591874 8:48800537-48800559 GAGCCACCGCGCCCAGCTCAAGG - Intergenic
1040790982 8:51230622-51230644 GAGCCACGGCGCCCGGCCGAAGG - Intergenic
1040858726 8:51977163-51977185 GAGCCACCGCGCCCGGCCAAAGG + Intergenic
1041054393 8:53968557-53968579 GAGCCACCGTGCCCAGCTGATGG - Intronic
1041061239 8:54036730-54036752 GAGCCACTGCGCCCAGCTGAGGG - Intergenic
1041196765 8:55408722-55408744 GAACCACCGCACCCGGCTTGTGG - Intronic
1041325998 8:56665088-56665110 GAGCCACCGCGCCCGGCCCAGGG + Intergenic
1041481151 8:58321132-58321154 GCGCCACCACGCCCGGCCGAGGG - Intergenic
1041634045 8:60122201-60122223 GAGCCACCACGCCGGGCTGAGGG + Intergenic
1041766990 8:61429135-61429157 GAGCCACCGCACCCAGCTGCAGG - Intronic
1041826002 8:62096762-62096784 GAGCCACAGCACCCGGCCTATGG - Intergenic
1041908387 8:63059314-63059336 GAGCCACCGCGCCCGGCCCAGGG + Intronic
1041916520 8:63144684-63144706 GAGCCACCGCACCTGGCTGGGGG + Intergenic
1042236397 8:66617226-66617248 GAGCCACCGCACCTGTCCGATGG - Intergenic
1042312563 8:67393405-67393427 GAGCCACCGCACCTGGCTGAAGG - Intergenic
1042436748 8:68774820-68774842 GAGCCACCACACCCGGCCCAGGG - Intronic
1042582151 8:70291924-70291946 CCGCCACCGCACCCGGCTACGGG - Intronic
1042990431 8:74633167-74633189 GTGCCACCACCCCTGGCTAATGG + Intronic
1043110011 8:76169169-76169191 GAGCCACCGCGCCCGGCCCATGG + Intergenic
1043452147 8:80378610-80378632 GAGCCACCGCACCCGGCCACTGG + Intergenic
1043470457 8:80557119-80557141 GAGCCACTGCACCCGGCTGATGG - Intergenic
1043581614 8:81721517-81721539 GAGCCACCGCGCCCGGCTGCAGG - Intronic
1043975260 8:86578191-86578213 GAGCCACCGCACCCGGCCAAGGG + Intronic
1044104352 8:88184442-88184464 GAGCCACCACACCCAGCTCATGG - Intronic
1044114609 8:88319647-88319669 GTGCCTCTGCATGCGGCTGATGG - Intronic
1044185472 8:89245599-89245621 GAGCCACTGCACCCGGCCCAGGG + Intergenic
1044719019 8:95128111-95128133 GAGCCACCACACCCGGCCAAAGG - Intergenic
1045012702 8:97972131-97972153 GTGCCACCACCCCCAGCTAATGG + Intronic
1045053125 8:98344607-98344629 GAGCCACCGCGCCCGGCCGAGGG - Intergenic
1045220511 8:100194880-100194902 GAGCCACCGCGCCCAGCTGACGG - Intronic
1045526247 8:102943333-102943355 GAGCCACCGCACCTGGCCAAGGG - Intronic
1046575013 8:116017119-116017141 GTGCCACCTCAGCTGTCTGATGG + Intergenic
1046642474 8:116747823-116747845 GAGCCACCGCAGCAGGCTGGTGG - Intronic
1046728617 8:117700864-117700886 GAGCCACCGCGCCCGGCCTATGG + Intergenic
1046836807 8:118810971-118810993 GAGCCACCGCGCCTGGCTCAGGG - Intergenic
1046902802 8:119541060-119541082 GTGCCACCACTCCTGGCTAAAGG - Intergenic
1046908396 8:119599719-119599741 GAGCCACCACACCCAGCTGAGGG - Intronic
1047098874 8:121654852-121654874 GAGCCACCGCCCCCGGCTCTAGG + Intergenic
1047111081 8:121790148-121790170 GAGCCACCGCACCCGGCTCTGGG + Intergenic
1047137935 8:122102736-122102758 GAGCCACCGCACCCGGCCGAAGG + Intergenic
1047145427 8:122193707-122193729 GAGCCACCGCACCCGGCCTGGGG - Intergenic
1047197517 8:122734929-122734951 GAGCCACTGCACCTGGCCGATGG + Intergenic
1047312535 8:123704679-123704701 GAGCCACCGCACCCGGCCTGCGG + Intronic
1047502290 8:125451524-125451546 GAACCACCGCGCCCGGCTTATGG + Intergenic
1047561096 8:125988797-125988819 GAGCCACCACGCCCGGCCGAAGG + Intergenic
1048033252 8:130652724-130652746 GAGCCACCGCACCCGGCCAATGG - Intergenic
1048211234 8:132456027-132456049 GAGCCACCGTGCCCGGCCGATGG + Intronic
1048872677 8:138812300-138812322 CAGCCAGCGCACCCGGCTCAGGG - Intronic
1048975175 8:139667411-139667433 GAGCCACTGCGCCCGGCTGTGGG - Intronic
1049020772 8:139956443-139956465 GAGCCACCGCGCCCGGCCCATGG + Intronic
1049097869 8:140559362-140559384 GTCCCAGCACACCTGGCTGAGGG - Intronic
1049609402 8:143546862-143546884 GAGCCACCGCACCCGGCCACAGG + Intergenic
1049736560 8:144210152-144210174 GAGCCACCGCACCCGGCCATAGG - Intronic
1049768109 8:144364710-144364732 GAGCCACCGCACCCGGCTAAGGG - Intergenic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1050095818 9:2064898-2064920 GAGCCGCCGCACCCAGCTGATGG - Intronic
1050760140 9:9058731-9058753 GAGCCACCGCGCCCGGCCGAGGG + Intronic
1050792094 9:9485866-9485888 GAGCCACCCCACCCGGCCCAAGG - Intronic
1050813736 9:9782073-9782095 GAGCCACCGCACCCGGCCTTTGG + Intronic
1050913195 9:11100660-11100682 GAGCCACTGCGCGCGGCTGAAGG + Intergenic
1051237243 9:15014327-15014349 GAGCCACCATGCCCGGCTGAGGG + Intergenic
1051554585 9:18368197-18368219 GAGCCACCGCGCCTGGCTGAGGG + Intergenic
1051631917 9:19148436-19148458 GAGCCACTGCACCCAGCCGAGGG - Intronic
1051847299 9:21465750-21465772 GAGCCACCACACCCAGCTAAAGG - Intergenic
1052177926 9:25486904-25486926 GAGCCACCGCGCCTGTCTGAGGG + Intergenic
1052346792 9:27417776-27417798 GAGCCACCGCACCCGGCCAAAGG - Intronic
1052481402 9:29031565-29031587 GAGCCACCGCACCCAGCTGGTGG + Intergenic
1052645777 9:31231520-31231542 GAGCCACCGCGCCCAGCGGAGGG - Intergenic
1052751842 9:32499738-32499760 GAGCCACCACACCCGGCCCAGGG + Intronic
1052902474 9:33805298-33805320 GAGCCACCGCACCCGGCCATTGG + Intergenic
1052985029 9:34480657-34480679 GAGCCACTGCACCCGGCCAAAGG - Intronic
1053013736 9:34649994-34650016 GAGCCACCACACCCGGCCGATGG - Intronic
1053045353 9:34911534-34911556 GAGCCACCGCGCCCGGCCTATGG + Intergenic
1053201177 9:36152463-36152485 GAGCCACCGCACCCAGCCCATGG - Intronic
1053201357 9:36153614-36153636 GAGCCACCGCACCTGGCCAAAGG - Intronic
1053232246 9:36420246-36420268 GAGCCACCGTGCCCGGCCGAAGG - Intronic
1053354701 9:37435920-37435942 ATGCCACTGCACCCAGCTGACGG + Intronic
1053514210 9:38716185-38716207 GAGCCACCGCACCGGGCCAAGGG - Intergenic
1054754663 9:68945428-68945450 GAGCCACCGCACCCAGCCAATGG + Intronic
1054813615 9:69454466-69454488 GTGCCACAGCAGCCTGGTGAGGG + Intronic
1054976316 9:71149812-71149834 GTGCCACCACACTCAGCTAATGG - Intronic
1055102341 9:72478866-72478888 GAGCCACCGCACCCAGCCGGAGG + Intergenic
1055491183 9:76806800-76806822 GAGCCACCGCACCCGGCCTCAGG + Intronic
1055497484 9:76870399-76870421 GAGCCACCGCACCCGGCCGGAGG - Intronic
1055521812 9:77089090-77089112 GTGCCACCACACTCAGCTAATGG + Intergenic
1055861074 9:80749428-80749450 GAGCCACCACACCTGGCCGAAGG + Intergenic
1056425250 9:86468926-86468948 GAGCCACCACGCCCGGCCGAGGG - Intergenic
1056483492 9:87030792-87030814 GAGCCTCCGCGCCCGGCTGCAGG - Intergenic
1056633809 9:88315393-88315415 GAGCCATCACACCCGGCCGAAGG + Intergenic
1056647092 9:88422991-88423013 GAGCCACCACACCCAGCTGAGGG + Intronic
1056787127 9:89601310-89601332 GTGCCCCCGACCCCTGCTGAAGG + Intergenic
1056825848 9:89875845-89875867 GAGCCACCGCACTCGACTAAGGG - Intergenic
1057062460 9:92017909-92017931 GAGCCACTGCACCCGGCCTATGG - Intergenic
1057150565 9:92792631-92792653 GAGCCACCGCACCCGGCCAGAGG + Intergenic
1057217397 9:93236666-93236688 GTGGCTCCTCACCCAGCTGATGG - Intronic
1057403988 9:94751029-94751051 GAGCCACCGCACCTGGCCAAAGG + Intronic
1057479574 9:95434097-95434119 GAGCCACCGCGCCCGGCCTATGG + Intergenic
1057499934 9:95588946-95588968 GAGCCACTGCACCCGGCTCCAGG + Intergenic
1057508203 9:95654137-95654159 GAGCCACCACACCCGGCCGAAGG + Intergenic
1057521741 9:95765819-95765841 GAGCCACCGCGCCTGGCTGAGGG - Intergenic
1057596807 9:96421496-96421518 CAGCCACCGCGCCCAGCTGAAGG - Intergenic
1057787539 9:98098425-98098447 GAGCCACCGCACCCGGCCGATGG - Intronic
1057806419 9:98223014-98223036 GGGCCACGGCACCTGGCTCAGGG - Intronic
1057834333 9:98432178-98432200 GAGTCACTGCACCCGGCTCAAGG + Intronic
1057881146 9:98793815-98793837 GAGCCACCGCACCTGGCCAAAGG + Intronic
1058073662 9:100627917-100627939 GAGCCCCCGCGCCCGGCCGATGG + Intergenic
1058438752 9:104988452-104988474 GAGCCACTGCACCCGGCCAAGGG + Intergenic
1058448796 9:105077275-105077297 GAGCCACCGCACCTGGCCAAAGG + Intergenic
1058527510 9:105874769-105874791 GAGCCACCGCACCTGGCCAATGG + Intergenic
1058636830 9:107045846-107045868 GAGCCACTGCACCCGGCCCAGGG + Intergenic
1058661961 9:107274657-107274679 GAGCCACAGCACCCGGCCGGGGG + Intergenic
1058711016 9:107679203-107679225 GAGCCACCGCCCCCGGCCGGAGG + Intergenic
1058968561 9:110059182-110059204 GAGCCACCGCGCCCAGCCGATGG + Intronic
1059103289 9:111489969-111489991 GAGCCACCACACCCGGCCTAGGG - Intergenic
1059105599 9:111508970-111508992 GTGCCACCACGCCTGGCTGATGG - Intergenic
1059462141 9:114438733-114438755 GAGCCACCGCGCCTGGCTAACGG + Intronic
1059936959 9:119321213-119321235 GAGCCACCGCACCCGGCCATTGG + Intronic
1060111241 9:120908040-120908062 GTGCCACCACGCCCAGCTGATGG + Intronic
1060128081 9:121069660-121069682 GTGCCATCACACCCAGCTAATGG + Intergenic
1060250834 9:121985802-121985824 GAGCCACCGCGCCCGGCCCAAGG + Intronic
1060412574 9:123409805-123409827 GAGCCACCGCACCCGGCCAACGG - Intronic
1060499017 9:124138848-124138870 GGGCCACCGCACCCAGCCCAAGG - Intergenic
1060559858 9:124533931-124533953 GAGCCACCGCACCCGGCCAGGGG + Intronic
1060648977 9:125308194-125308216 GTGCCACCACACCAGGCTGAGGG - Intronic
1060710656 9:125860604-125860626 GAGCCACCGCACCTGGCCAATGG - Intronic
1060837486 9:126767379-126767401 GAGCCACCGCACCCGGCCTGTGG + Intergenic
1061028292 9:128064716-128064738 GAGCCACCGCGCCCGGCCGGGGG - Intronic
1061037872 9:128123528-128123550 GAGCCACCACGCCCGGCTGCAGG + Intronic
1061118890 9:128631127-128631149 GAGCCACCACTCCCGGCCGAGGG + Intronic
1061164686 9:128915607-128915629 GAGCCACCGCACCCGGCCTAGGG + Intronic
1061167463 9:128932117-128932139 GAGCCACCGCACCCGGCCTGGGG + Intronic
1061191996 9:129087598-129087620 GAGCCACCTCGCCCGGCCGAAGG + Intronic
1061254155 9:129444333-129444355 GAGCCACCGCACCCGGCCTTGGG + Intergenic
1061309868 9:129755154-129755176 GAGCCACCGCACCTGGCCAAGGG + Intergenic
1061326130 9:129865812-129865834 GAGCCACTGCACCCGGCGGAGGG + Intronic
1061364524 9:130164906-130164928 GAGTCACCGCGCCCGGCCGAGGG + Intergenic
1061378288 9:130239065-130239087 GAGCCACCGCGCCCGGCCGAGGG - Intergenic
1061465960 9:130779999-130780021 GAGCCACCGCGCCCGGCCCAGGG - Intronic
1061508694 9:131047449-131047471 GAGCCACCGCACCCGGCCTCTGG + Intronic
1061515295 9:131086360-131086382 GAGCCACTGCACCCAGCTTAAGG + Intronic
1061536661 9:131254543-131254565 GAGCCACTGCGCCCGGCCGATGG - Intergenic
1061537931 9:131260977-131260999 GGGCCAGCGCGCCCGGCTGCGGG - Exonic
1062221965 9:135421240-135421262 GAGCCACCGCACCCGGCCCCAGG + Intergenic
1062362669 9:136194987-136195009 GAGCCACCGCACCTGGCCAAGGG - Intergenic
1062420825 9:136481420-136481442 GAGCCACCGCGCCCGGCCCAGGG + Intronic
1062638572 9:137504902-137504924 GAGCCACGGCGCCCGGCTGATGG - Intronic
1062671225 9:137710924-137710946 CTCCCACTGAACCCGGCTGACGG + Intronic
1062717139 9:138016674-138016696 GTGCCCCCGCACCCTGCGGCGGG - Intronic
1203585419 Un_KI270746v1:64953-64975 GAGCCACCACACCCGGCCTAGGG + Intergenic
1185471758 X:387908-387930 GAGCCACCGCGCCCGGCCAAGGG - Intergenic
1185489483 X:510186-510208 GAGCCACCGCGCCCGGCAAAGGG + Intergenic
1185497067 X:563368-563390 GAGCCACCGCGCCCGACCGAGGG + Intergenic
1185503492 X:616253-616275 GAGCCACCGCGCCCGGCTTGGGG - Intergenic
1185515625 X:697020-697042 GAGCCACCGCTCCCGGCCTAAGG + Intergenic
1185554683 X:1011187-1011209 GAGCCACCGCGCCCGGCCGCGGG - Intergenic
1185570491 X:1131196-1131218 GAGCCACCGCGCCCGGCTGAGGG - Intergenic
1185595412 X:1303658-1303680 GAGCCACCGCATCCGGCCCATGG + Intronic
1185625301 X:1476902-1476924 GAGCCACTGCTCCAGGCTGACGG - Intronic
1185636205 X:1553961-1553983 GAGCCACCGCACCCGGCCTGGGG - Intergenic
1185679702 X:1878629-1878651 GAGCCACCGCACCCGGCTTTGGG - Intergenic
1185716769 X:2348976-2348998 GAGCCACCGCGCCCGGCTGTGGG + Intronic
1185719429 X:2370453-2370475 GAGCCACCGCGCCCAGCTGAGGG + Intronic
1185919073 X:4069046-4069068 GAGCCACCGCGCCCGGCTGAGGG - Intergenic
1186104701 X:6193135-6193157 GAGCCACCGCGCCCGGCCCAGGG - Intronic
1186498198 X:10029327-10029349 GAGCCACTGCACCCAGCTAAGGG - Intronic
1186686447 X:11929821-11929843 GAGCCACCGCACCCGGCTGATGG - Intergenic
1187014326 X:15310701-15310723 AAGCCACCGCGCCCGGCTGTTGG - Intronic
1187277351 X:17827823-17827845 GTGCCACCTCTGCAGGCTGAGGG + Intronic
1187408640 X:19026778-19026800 TAGCCACCGCACCCGGCCAAGGG + Intronic
1187414365 X:19080192-19080214 GAGCCACCGCGCCCGGCTGAGGG + Intronic
1187528325 X:20073850-20073872 GAGCCACCGCGCCCGGCCGGTGG - Intronic
1187863283 X:23701787-23701809 GAGCCACTGCACCCGGCCGGTGG - Intergenic
1187868700 X:23746736-23746758 GAGCCACCGCGCCCGGCCAAAGG + Intronic
1187955824 X:24517505-24517527 GAGCCACTGCACCCGGCTCAAGG + Intronic
1188000447 X:24975292-24975314 GGGCCACCGCACCCGGCCCTTGG + Intronic
1188018487 X:25130627-25130649 GAGCCACTGCGCCCGGCCGAGGG + Intergenic
1188426511 X:30053392-30053414 GAGCCACCGCACCCAGCCCAGGG + Intergenic
1188544999 X:31295277-31295299 GAGCCACCGCGCCCGGCCGTAGG + Intronic
1188546904 X:31317793-31317815 GAGCCACCGCACCCGGCCTGAGG + Intronic
1188688243 X:33096788-33096810 GAGCCACCGCACCTGGCCAAAGG + Intronic
1188894177 X:35645902-35645924 GAGCCACCACACCCGGCCCAGGG + Intergenic
1189352797 X:40289410-40289432 ATGCCACCACACCCAGCTTAAGG + Intergenic
1189415404 X:40808545-40808567 GAGCCACTGCACCCGGCCAATGG - Intergenic
1189606974 X:42689203-42689225 GTGCCACCACACCTGGCTAATGG - Intergenic
1190011780 X:46791454-46791476 GAGCCACCGCACCCGGCCTGTGG - Intergenic
1190043176 X:47088645-47088667 GAGCCACCGCGCCCGGCCAAAGG - Intronic
1190126747 X:47712241-47712263 GAGCCACTGCGCCTGGCTGATGG + Intergenic
1190202696 X:48377446-48377468 GAGCCACCACACCCGGCCTACGG - Intergenic
1190207842 X:48417964-48417986 GAGCCACCACACCCGGCCTACGG + Intergenic
1190280331 X:48924992-48925014 GAGCCACCGCACCCGGCTGAAGG - Intronic
1190295201 X:49022444-49022466 GTGCCACCACACCCGGCATGGGG - Intergenic
1190682254 X:52836835-52836857 GAGCCACCGCACCCGGCCAAAGG + Intergenic
1190859363 X:54329352-54329374 GAGCCACCGCACCTGGCTGTAGG - Intronic
1190875456 X:54456913-54456935 GAGCCACCGCACCCGGCCTCGGG + Intronic
1191875015 X:65787507-65787529 GAGCCACCGCGCCCGGCCGATGG + Intergenic
1192224788 X:69220877-69220899 GAGCCACCGCACCCGGCCAGTGG - Intergenic
1192458038 X:71293912-71293934 GAGCCACCGTACCCGGCCAATGG + Intronic
1192498661 X:71633973-71633995 GTGCCACCACACCGGGCTCTGGG - Intergenic
1192542368 X:71985105-71985127 GAGCCACCGTGCCCGGCTGATGG + Intergenic
1192736800 X:73856852-73856874 GAGCCACCGCACCCGGCCACTGG - Intergenic
1192780631 X:74291169-74291191 GAGCCACCACGCCCGGCTGCTGG - Intergenic
1193804141 X:85973014-85973036 GAGCCACCGCGCCCGGCCTATGG - Intronic
1193918376 X:87395958-87395980 GAGCCACCGCACCCAGCTAATGG - Intergenic
1194014392 X:88601032-88601054 GAGCCACCGCGCCTGGCTGGTGG + Intergenic
1194275488 X:91875573-91875595 GAGCCACCGCTCCCGGCCGAGGG + Intronic
1194472185 X:94310278-94310300 GAGCCACCGCGCCCGGCCCATGG + Intergenic
1194539001 X:95146878-95146900 GAGCCACTGCACCCGGCCAAAGG + Intergenic
1195051652 X:101102643-101102665 GAGCCACCGCACCTGGCTCGAGG + Intronic
1195067449 X:101250508-101250530 CTGCCACTTCACCCAGCTGACGG - Exonic
1195637424 X:107133619-107133641 GAACCACTGCACCCTGCTGAAGG + Intronic
1195732887 X:107983009-107983031 GAGCCACCGCGCCCGGCCGAAGG - Intergenic
1195773075 X:108373116-108373138 GAGCCACCGTGCCTGGCTGAAGG - Intronic
1195784370 X:108502567-108502589 GAGCCACCGCGCCCGGCTACTGG + Intronic
1196042044 X:111215272-111215294 GAGCCACTGCGCCCAGCTGAAGG - Intronic
1196302053 X:114058892-114058914 GAGCCACCGCACCAGGCCCAGGG + Intergenic
1196414203 X:115454009-115454031 GAGCCACCACACCTGGCTGAGGG - Intergenic
1196415138 X:115463342-115463364 GAGCCACCGCGCCTGGCAGAAGG + Intergenic
1196784915 X:119413419-119413441 GAGCCACCGCGCCCGGCCTAAGG - Intronic
1197523229 X:127526046-127526068 GAGCCACCGCGCCCGGCCAAGGG - Intergenic
1198003404 X:132464753-132464775 GAGCCACCGCACCGGCCAGATGG - Intronic
1198307654 X:135398861-135398883 GAGCCACCGCGCCCGGCTATAGG + Intergenic
1198740366 X:139835687-139835709 GAGCCACCGCACCCAGCTAGTGG + Intronic
1198756073 X:139983788-139983810 GAGCCACCGCGCCCGGCTGAAGG + Intergenic
1198770707 X:140127014-140127036 GAGCCACCGCTCCCGGCCTAGGG - Intergenic
1198808092 X:140508655-140508677 GAGCCACCGCGCCCGGCTGAGGG - Intergenic
1198811074 X:140536997-140537019 GAGCCACCGCACCCGGCCAAAGG - Intergenic
1198811653 X:140541947-140541969 GAGCCACCGCACCCAGCTGGGGG + Intergenic
1198814963 X:140580160-140580182 GTGCCACAGCACCCGGCTAGTGG - Intergenic
1198868981 X:141155929-141155951 GAGCCACCACGCCCAGCTGAGGG + Intergenic
1199023661 X:142911950-142911972 GAGCCACCACACCTGGCCGAAGG - Intergenic
1199152480 X:144503845-144503867 GAGCCACCGCGCCCGGCCAACGG + Intergenic
1199222120 X:145329312-145329334 GAGCCACCGCACCTGGCTGCTGG - Intergenic
1199349485 X:146784195-146784217 GAGCCACCGCACCTGGCCTAGGG - Intergenic
1200161500 X:154012193-154012215 GAGCCACCTCGCCCAGCTGAGGG + Intronic
1200184017 X:154170055-154170077 GAGCCACCACACCTGGCTGGAGG - Intergenic
1200189671 X:154207183-154207205 GAGCCACCACACCTGGCTGGAGG - Intergenic
1200195424 X:154244992-154245014 GAGCCACCACACCTGGCTGGAGG - Intergenic
1200201076 X:154282113-154282135 GAGCCACCACACCTGGCTGGAGG - Intronic
1200208724 X:154335920-154335942 GAGCCACCTCACCCAGCTGTAGG - Intergenic
1200249544 X:154545548-154545570 GAGCCACCACGCCCGGCTGCAGG - Intronic
1200592734 Y:5096995-5097017 GAACCACCGCTCCCGGCCGAGGG + Intronic
1201387008 Y:13452082-13452104 GAGCCACTGCACCTGGCTGGTGG - Intronic
1201490534 Y:14536529-14536551 GAGCCACCGCACCCAGCCGAAGG + Intronic
1202199742 Y:22333751-22333773 GAGCCACCGCGCCCAGCTCATGG - Intronic
1202331041 Y:23753358-23753380 GAGCCACCGCGCCCGGCCTATGG - Intergenic
1202539728 Y:25916703-25916725 GAGCCACCGCGCCCGGCCTATGG + Intergenic