ID: 1064569191

View in Genome Browser
Species Human (GRCh38)
Location 10:16674742-16674764
Sequence ACTGAATATAAGTGTAAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064569190_1064569191 -6 Left 1064569190 10:16674725-16674747 CCTAAGGTCATTTAGAAACTGAA No data
Right 1064569191 10:16674742-16674764 ACTGAATATAAGTGTAAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064569191 Original CRISPR ACTGAATATAAGTGTAAAGC CGG Intronic
No off target data available for this crispr