ID: 1064569858

View in Genome Browser
Species Human (GRCh38)
Location 10:16681644-16681666
Sequence TCAAACTAGATCATCTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 158}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064569858_1064569866 15 Left 1064569858 10:16681644-16681666 CCCTCAGAGATGATCTAGTTTGA 0: 1
1: 0
2: 2
3: 21
4: 158
Right 1064569866 10:16681682-16681704 GATGGGGAAGCTGAGGTGGGTGG No data
1064569858_1064569867 16 Left 1064569858 10:16681644-16681666 CCCTCAGAGATGATCTAGTTTGA 0: 1
1: 0
2: 2
3: 21
4: 158
Right 1064569867 10:16681683-16681705 ATGGGGAAGCTGAGGTGGGTGGG No data
1064569858_1064569864 11 Left 1064569858 10:16681644-16681666 CCCTCAGAGATGATCTAGTTTGA 0: 1
1: 0
2: 2
3: 21
4: 158
Right 1064569864 10:16681678-16681700 TGCAGATGGGGAAGCTGAGGTGG No data
1064569858_1064569860 -3 Left 1064569858 10:16681644-16681666 CCCTCAGAGATGATCTAGTTTGA 0: 1
1: 0
2: 2
3: 21
4: 158
Right 1064569860 10:16681664-16681686 TGAAACTTGAGCTGTGCAGATGG No data
1064569858_1064569861 -2 Left 1064569858 10:16681644-16681666 CCCTCAGAGATGATCTAGTTTGA 0: 1
1: 0
2: 2
3: 21
4: 158
Right 1064569861 10:16681665-16681687 GAAACTTGAGCTGTGCAGATGGG No data
1064569858_1064569868 22 Left 1064569858 10:16681644-16681666 CCCTCAGAGATGATCTAGTTTGA 0: 1
1: 0
2: 2
3: 21
4: 158
Right 1064569868 10:16681689-16681711 AAGCTGAGGTGGGTGGGATGAGG No data
1064569858_1064569865 12 Left 1064569858 10:16681644-16681666 CCCTCAGAGATGATCTAGTTTGA 0: 1
1: 0
2: 2
3: 21
4: 158
Right 1064569865 10:16681679-16681701 GCAGATGGGGAAGCTGAGGTGGG No data
1064569858_1064569863 8 Left 1064569858 10:16681644-16681666 CCCTCAGAGATGATCTAGTTTGA 0: 1
1: 0
2: 2
3: 21
4: 158
Right 1064569863 10:16681675-16681697 CTGTGCAGATGGGGAAGCTGAGG No data
1064569858_1064569862 -1 Left 1064569858 10:16681644-16681666 CCCTCAGAGATGATCTAGTTTGA 0: 1
1: 0
2: 2
3: 21
4: 158
Right 1064569862 10:16681666-16681688 AAACTTGAGCTGTGCAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064569858 Original CRISPR TCAAACTAGATCATCTCTGA GGG (reversed) Intronic
902406042 1:16184239-16184261 TCAAACTGGCTCATCCCTGGGGG - Intergenic
909966116 1:81912591-81912613 TCAAATTACATAATCTCTGTGGG - Intronic
911398113 1:97337565-97337587 TCAAACGAGATCTTAGCTGATGG + Intronic
913276686 1:117145183-117145205 TAAAACTAGGTCATATCTGGTGG + Exonic
916022560 1:160806839-160806861 TCAAATTATTTCATCCCTGAGGG - Intronic
916995073 1:170287991-170288013 TCCTACTAGATCATGACTGATGG - Intergenic
917300810 1:173572029-173572051 TAATAATAGATCATCTCAGAGGG - Intronic
918888465 1:190229765-190229787 TGAAACTAAATCTTCTCTGAAGG + Intronic
919313860 1:195947478-195947500 TCAAACTGGAACAATTCTGAAGG + Intergenic
919460112 1:197866726-197866748 ACAAATTATATCATTTCTGAAGG - Intergenic
923618215 1:235555308-235555330 TCAGAATAGATCATCTCTTGTGG + Intronic
924004231 1:239590105-239590127 ACAGACTAGATGATCTATGAAGG - Intronic
1063163745 10:3441236-3441258 TTAGACTAGATCATCTCTAAGGG - Intergenic
1063479372 10:6360445-6360467 TCAATCTACTTCATTTCTGAAGG + Intergenic
1064569858 10:16681644-16681666 TCAAACTAGATCATCTCTGAGGG - Intronic
1065310522 10:24411987-24412009 TAAAACTAGAGCATCGCCGAGGG + Intronic
1065348887 10:24777353-24777375 CCAAACTAGATCAATTTTGAAGG + Intergenic
1068401757 10:56536817-56536839 TCAATCTGGAGCATCTCTGAAGG - Intergenic
1068686109 10:59871529-59871551 ACAAACTGGGTCAGCTCTGAGGG + Intronic
1069055931 10:63844730-63844752 TCATCTTAGATCTTCTCTGAGGG + Intergenic
1072187681 10:93057195-93057217 TGAAACTACACCAACTCTGAAGG - Intronic
1074156192 10:110801922-110801944 TCCATCTGGATCTTCTCTGATGG + Intronic
1074259129 10:111834254-111834276 CCAAACTGGCTCATCTGTGAAGG - Intergenic
1074316379 10:112365087-112365109 TCATGCCAGATCCTCTCTGAAGG - Intergenic
1076250598 10:128981124-128981146 TCAAACAAGCTCCTCTCTGTGGG + Intergenic
1079588163 11:22150686-22150708 TCTAACTTGATTAGCTCTGAAGG + Intergenic
1082931056 11:58605943-58605965 TCATACTGGATCATCTCTGTTGG + Intronic
1083513062 11:63229503-63229525 TCATACTTGATCATCGCTGCTGG - Exonic
1083798545 11:65032675-65032697 TCAAATGAGGTCATCTCTAAGGG - Intronic
1085573170 11:77577436-77577458 TCAGACTTGATCAAATCTGAAGG + Intronic
1085646791 11:78229174-78229196 TCAAGATAAAACATCTCTGAAGG - Intronic
1086226412 11:84515814-84515836 CCAAAATAGATCATGTGTGAGGG + Intronic
1086424203 11:86668480-86668502 CCAGACTAGATCATCTCTGAGGG + Intronic
1086777313 11:90854658-90854680 TCAAATTAAATCATCTCTGATGG + Intergenic
1088463214 11:110104719-110104741 TCAAAGTAGATCATGTTTGATGG - Intronic
1088858818 11:113780782-113780804 TCACACTAGATTTTCTCTGATGG - Intergenic
1092758920 12:11791413-11791435 TCAAACTAGAGCTTCTCAGGAGG + Intronic
1094467771 12:30771874-30771896 TCCAACTTGATCAAATCTGAAGG + Intergenic
1095388711 12:41679818-41679840 CCAAACTAGATCAGCTCTCCTGG - Intergenic
1095915427 12:47473302-47473324 TTGAACAAGATCATCTATGAGGG - Intergenic
1097644313 12:62217632-62217654 TCAAAGTAGGCCAACTCTGAAGG + Intronic
1099106539 12:78503748-78503770 TTAAATTAGATCATTTATGAAGG + Intergenic
1099158465 12:79209517-79209539 TCGATTTAGTTCATCTCTGAAGG - Intronic
1103186732 12:118964508-118964530 TCAAAATAGATAGACTCTGAGGG - Intergenic
1105322530 13:19341776-19341798 TCAAACAAAAGCATTTCTGAAGG - Intergenic
1105741478 13:23328222-23328244 TCCAACTAGATCAACTATCAAGG + Intergenic
1105875083 13:24545054-24545076 TCAAACAAAAGCATTTCTGAAGG + Intergenic
1106661969 13:31809279-31809301 TCTAACAAGATCATCTCCAAGGG + Intergenic
1107908193 13:45081579-45081601 TGAAAGTAGATCTTCCCTGATGG + Intergenic
1108166627 13:47699987-47700009 TCAAACAAGATCATCTTTAGTGG - Intergenic
1108461504 13:50671869-50671891 TTATTCTAGATCATCTTTGAAGG - Intronic
1110097648 13:71549778-71549800 TCAAACAAGATTCCCTCTGATGG - Intronic
1110258838 13:73462451-73462473 TCAAGCTAAGTCATCTCGGAAGG - Intergenic
1111590102 13:90335223-90335245 TCAAAATATAGCATCTTTGAAGG + Intergenic
1116929608 14:50676927-50676949 TCAAAGTAGGTCTTCTCAGAAGG - Intergenic
1117732626 14:58739040-58739062 TGAAACTAGTCCATCTCTGAAGG - Intergenic
1124066729 15:26351552-26351574 TTAAAATATAACATCTCTGAGGG + Intergenic
1127922762 15:63505437-63505459 TCAAACTTCACCATCCCTGACGG - Intronic
1129064837 15:72893429-72893451 TCAAACTAGAGCAGGTCAGAGGG - Intergenic
1130144690 15:81265003-81265025 TTAAATCAGATCATCTGTGAAGG + Intronic
1130400576 15:83549355-83549377 TAAAACTAGATAATCTCTGGAGG - Intronic
1131342719 15:91617585-91617607 CCAAACCATATCATTTCTGATGG + Intergenic
1133452489 16:5915497-5915519 TAAAAGTAGGTCCTCTCTGAAGG - Intergenic
1139154777 16:64427375-64427397 TTAAAGTGGAACATCTCTGATGG + Intergenic
1140419718 16:74808334-74808356 TCCAACTTGATCATATCTGAAGG + Intergenic
1144644714 17:16964295-16964317 TCAACCTTGAACATCTCTGAAGG - Intronic
1147847461 17:43414615-43414637 TCAAACTACCACATCTCTTATGG - Intergenic
1148151705 17:45400540-45400562 TCAATGAAGATCATCACTGATGG - Intronic
1149056895 17:52377463-52377485 TAAAACTAGAATATCTATGAGGG - Intergenic
1149283781 17:55138514-55138536 TCAAAACAGATGATCACTGATGG + Intronic
1151041314 17:70863778-70863800 CAAAACAAGATCATCTTTGAGGG - Intergenic
1154457075 18:14539749-14539771 TCAAACAAAAGCATTTCTGAAGG - Intronic
1155821410 18:30382582-30382604 TCAAACTGGATCCAATCTGAGGG + Intergenic
1157533742 18:48443307-48443329 TCAGACTAGCTGATCTGTGAGGG + Intergenic
1158327939 18:56330320-56330342 TCAAAATAATTCCTCTCTGATGG + Intergenic
1160388883 18:78515344-78515366 TCAAACTTGATGATGTCTCAGGG - Intergenic
1167092964 19:47357405-47357427 TCCAGCTAGATAATTTCTGAAGG - Intronic
1168486669 19:56768371-56768393 TCACCCAAGATCATCTCTGCTGG - Intergenic
925504287 2:4543585-4543607 TCAAACCATATCATCACTCATGG + Intergenic
925888756 2:8416141-8416163 GCAAAATAGAAAATCTCTGAAGG + Intergenic
927371465 2:22360184-22360206 TCAAACTACATATTCTCTGCAGG + Intergenic
930106662 2:47645638-47645660 TCAAACCAGAGCATTTCTGCAGG - Intergenic
932300909 2:70666464-70666486 TCAAACTAGACCCTCACTGCAGG + Intronic
932695318 2:73951401-73951423 TCAATCTAGACGATCTCTAAGGG + Intronic
934123640 2:88865196-88865218 TCCAACTAACTCATCACTGAAGG + Intergenic
935958020 2:108397974-108397996 TCTGACTTGATCATGTCTGAAGG - Intergenic
936628211 2:114171709-114171731 TCAACATATATGATCTCTGAAGG + Intergenic
939070955 2:137541885-137541907 TCAGACTAGATCATCTCAATTGG - Intronic
939081930 2:137673117-137673139 TCAAACTAGTTAATCTCTCCTGG + Intronic
941208782 2:162609521-162609543 TTAGACTAAATGATCTCTGAGGG - Intronic
941270935 2:163427900-163427922 TGAAAGTACATCATCTCTGTGGG - Intergenic
943823450 2:192357481-192357503 TGAAAATAGCACATCTCTGAAGG - Intergenic
945501910 2:210586392-210586414 TCAAACTAAATCATTTCACAGGG - Intronic
947414743 2:229883112-229883134 TTGAACTTGATCATCTCCGAGGG - Intronic
1168860304 20:1041547-1041569 TCCAACTTGATCAGCGCTGATGG - Intergenic
1171433231 20:25099994-25100016 TAAAACTAGGTCATATCTGGTGG - Intergenic
1172419529 20:34803697-34803719 TCAAAGAAGTTCATCACTGACGG + Intronic
1173600293 20:44290161-44290183 TCAATTTAGGACATCTCTGAAGG + Intergenic
1173707583 20:45123963-45123985 TCAGACTAGGTGGTCTCTGAGGG + Intronic
1175598720 20:60255789-60255811 TCACATAAAATCATCTCTGACGG + Intergenic
1176817084 21:13613588-13613610 TCAAACAAAAGCATTTCTGAAGG + Intronic
1177589579 21:23145197-23145219 TCCAACTTGATCAAATCTGAAGG - Intergenic
1178607126 21:34048118-34048140 TCAAACTATATGTTTTCTGAGGG - Intergenic
1178710127 21:34909719-34909741 TGAAACAAGCTCATCTCTCATGG - Intronic
1182770231 22:32789837-32789859 TCAAGTTAGGTCATCTCTGATGG + Intronic
1184319808 22:43732269-43732291 TCAGTCGAGATCATCTCTGCTGG - Intronic
950294630 3:11818278-11818300 CCAAACTAGGTCACTTCTGAGGG + Intronic
951269858 3:20610825-20610847 TCAAACTAGATGCCCTCTCATGG + Intergenic
955616319 3:60811010-60811032 TCAAATTACATCATTTCTCAGGG + Intronic
955956842 3:64299060-64299082 TCAGACTAGATCATCTCAATTGG - Intronic
956156019 3:66297825-66297847 CTAGACTAGATCATCTTTGAGGG + Intronic
956750154 3:72338712-72338734 TCAGTCAAGATCATCACTGACGG - Intergenic
957312315 3:78536796-78536818 ACAAACTACATTATCTCTGATGG - Intergenic
957996326 3:87694354-87694376 TCAAATTAGATCATTTCCTAAGG - Intergenic
958627845 3:96648781-96648803 TCAAACTTGTTCAGTTCTGATGG - Intergenic
958843948 3:99242506-99242528 TGAAAGTAGATCATCCCAGAGGG - Intergenic
958916722 3:100058388-100058410 TAAAATGAGATCACCTCTGAAGG + Intronic
960072095 3:113441904-113441926 TAAAACTATATTATCTCTGTTGG + Intergenic
963696241 3:148569007-148569029 CCAGACTAGATTATCACTGAAGG - Intergenic
965050868 3:163645729-163645751 TCAACCTAGATGATCTTTTATGG - Intergenic
965485035 3:169268140-169268162 TGAAACTAAATCATCTGGGATGG + Intronic
965699382 3:171444006-171444028 TCAAAATAGTTCTTCTATGAGGG + Intronic
966126704 3:176586027-176586049 GGAAACTGCATCATCTCTGAGGG + Intergenic
969228494 4:5814251-5814273 TCATAATACATCATCTCTCATGG - Exonic
969881433 4:10177394-10177416 ATAAACTTGATCATCTCTTACGG - Intergenic
969903740 4:10373765-10373787 TCAAACTACTTCATCTCTGCAGG + Intergenic
970650505 4:18172226-18172248 GCAAACTATATAATCTCTAAAGG + Intergenic
970653391 4:18202643-18202665 TGAAAGAAGATCATCTCTGTGGG + Intergenic
972084742 4:35201517-35201539 TCAAACAATACCATCTCTGTTGG - Intergenic
972811113 4:42586987-42587009 TGGAACTAGATCATCACAGAGGG - Intronic
976517326 4:85983874-85983896 TAAAATTAGATCATATCTGAGGG + Intronic
981354761 4:143775779-143775801 TGAAAATTGATCATCTCTCAAGG + Intergenic
982635309 4:157888125-157888147 TTAAACTGGATGATCTCTCAGGG + Intergenic
983277554 4:165636371-165636393 TCACACTAGCTCACCACTGATGG + Intergenic
986450322 5:7857011-7857033 TGAAACTAGAGGATCTCTGGAGG - Intronic
987448538 5:18052873-18052895 TCAAAAAAGATCATCTATGAAGG + Intergenic
989608723 5:43271308-43271330 TCAAAGTCAGTCATCTCTGAGGG + Intronic
990650350 5:57891757-57891779 TCAACTCAGATCAGCTCTGAAGG - Intergenic
993788131 5:92170364-92170386 TCAAAGTACATTTTCTCTGATGG - Intergenic
994264291 5:97696536-97696558 GAAAACTAAATGATCTCTGATGG - Intergenic
999007216 5:147996353-147996375 TAAAACTTGATCATCTGTAAAGG - Intergenic
1000360692 5:160443980-160444002 ACAAACAAGATTATTTCTGATGG + Intergenic
1000975009 5:167755103-167755125 GCAAGCCAGATCATCTCTTATGG + Intronic
1001173431 5:169443289-169443311 TTGGACTAGATCATCTCTGAGGG - Intergenic
1003008154 6:2400754-2400776 CCAAACTGTATCATCTGTGAAGG + Intergenic
1006119811 6:31796902-31796924 TCACACTAGATGGTCTCTAAGGG + Intergenic
1008925462 6:56887506-56887528 ATAAACTAGACCATCTTTGAAGG + Intronic
1009057867 6:58359641-58359663 TCAAACTAGAGAATCTTTCAAGG + Intergenic
1009232966 6:61087453-61087475 TCAAACTAGAGAATCTTTAAAGG - Intergenic
1010352658 6:74893333-74893355 TTAAATTAGATCATATATGATGG + Intergenic
1010788915 6:80040906-80040928 TCAAAGTAGATCATCACATAAGG + Intronic
1014787262 6:125633362-125633384 TCAATCTGGAGTATCTCTGAAGG - Intergenic
1016391255 6:143578303-143578325 TCAAACTAGATCATCCTAGAAGG - Intronic
1021843342 7:24741052-24741074 TTGGACTAGATGATCTCTGAAGG - Intronic
1022425962 7:30269094-30269116 TCAAAAAAGATCAACACTGATGG + Intergenic
1023516442 7:41006479-41006501 TCAAACTTCATTATTTCTGATGG - Intergenic
1026405466 7:70061114-70061136 TCAAACTAGGTGACCTCTCAAGG + Intronic
1027264819 7:76488572-76488594 GGAAAGTGGATCATCTCTGATGG - Intronic
1027316192 7:76986675-76986697 GGAAAGTGGATCATCTCTGATGG - Intergenic
1031870406 7:127084642-127084664 GCAGAGTAGATCATCACTGAGGG + Intronic
1040125978 8:43738350-43738372 TCTAACTGGATAATCTGTGAAGG + Intergenic
1043309052 8:78835485-78835507 TCTAATTAGATCACCTCTGAAGG + Intergenic
1046370644 8:113301798-113301820 TCAAACTTGAACATCTATGAAGG + Intronic
1048237353 8:132703958-132703980 TAAACCCACATCATCTCTGATGG - Intronic
1048697882 8:137048653-137048675 TCAAAATAAATGATCTCTAAAGG + Intergenic
1049456107 8:142690178-142690200 TCCAACTTGATCAACTCTGAAGG - Intergenic
1049497181 8:142941516-142941538 TAAAACTAGGTCCTTTCTGATGG - Intergenic
1050608983 9:7331447-7331469 TCATTCTAGTTTATCTCTGAAGG + Intergenic
1052830153 9:33208596-33208618 CCAGACTAGCACATCTCTGATGG + Intergenic
1056622135 9:88223312-88223334 TCAGAATAGATCATATCTCAAGG - Intergenic
1057230854 9:93320583-93320605 TCAAACTATTTCCTCTCTGGTGG + Intronic
1203530277 Un_GL000213v1:135903-135925 TCAAACAAAAGCATTTCTGAAGG - Intergenic
1186783696 X:12939822-12939844 TCCAACTTGATCAAATCTGAAGG - Intergenic
1186904386 X:14095732-14095754 TCACACTCGATCATATCTTAAGG + Intergenic
1189279806 X:39813165-39813187 TCAATTTAGGACATCTCTGAAGG - Intergenic
1195150324 X:102061368-102061390 TCCAACTTGATCAAATCTGAAGG + Intergenic
1197622407 X:128765249-128765271 CCAAACTAGATGATCTTTAAGGG + Intergenic
1198332430 X:135634064-135634086 TTAAAGTAGGTCTTCTCTGATGG - Intergenic
1198364731 X:135929132-135929154 TTAAAGTAGGTCTTCTCTGATGG - Intergenic
1198880866 X:141279750-141279772 TTAAACTAGTTGATCTCTGAGGG - Intergenic
1199345765 X:146737468-146737490 CCAAACTAAATCATGTCTCAAGG - Intergenic
1199574432 X:149299751-149299773 TCAAACTGGATAATCCATGAGGG - Intergenic