ID: 1064569859

View in Genome Browser
Species Human (GRCh38)
Location 10:16681645-16681667
Sequence TTCAAACTAGATCATCTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 207}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064569859_1064569864 10 Left 1064569859 10:16681645-16681667 CCTCAGAGATGATCTAGTTTGAA 0: 1
1: 0
2: 3
3: 17
4: 207
Right 1064569864 10:16681678-16681700 TGCAGATGGGGAAGCTGAGGTGG No data
1064569859_1064569860 -4 Left 1064569859 10:16681645-16681667 CCTCAGAGATGATCTAGTTTGAA 0: 1
1: 0
2: 3
3: 17
4: 207
Right 1064569860 10:16681664-16681686 TGAAACTTGAGCTGTGCAGATGG No data
1064569859_1064569868 21 Left 1064569859 10:16681645-16681667 CCTCAGAGATGATCTAGTTTGAA 0: 1
1: 0
2: 3
3: 17
4: 207
Right 1064569868 10:16681689-16681711 AAGCTGAGGTGGGTGGGATGAGG No data
1064569859_1064569865 11 Left 1064569859 10:16681645-16681667 CCTCAGAGATGATCTAGTTTGAA 0: 1
1: 0
2: 3
3: 17
4: 207
Right 1064569865 10:16681679-16681701 GCAGATGGGGAAGCTGAGGTGGG No data
1064569859_1064569863 7 Left 1064569859 10:16681645-16681667 CCTCAGAGATGATCTAGTTTGAA 0: 1
1: 0
2: 3
3: 17
4: 207
Right 1064569863 10:16681675-16681697 CTGTGCAGATGGGGAAGCTGAGG No data
1064569859_1064569867 15 Left 1064569859 10:16681645-16681667 CCTCAGAGATGATCTAGTTTGAA 0: 1
1: 0
2: 3
3: 17
4: 207
Right 1064569867 10:16681683-16681705 ATGGGGAAGCTGAGGTGGGTGGG No data
1064569859_1064569866 14 Left 1064569859 10:16681645-16681667 CCTCAGAGATGATCTAGTTTGAA 0: 1
1: 0
2: 3
3: 17
4: 207
Right 1064569866 10:16681682-16681704 GATGGGGAAGCTGAGGTGGGTGG No data
1064569859_1064569861 -3 Left 1064569859 10:16681645-16681667 CCTCAGAGATGATCTAGTTTGAA 0: 1
1: 0
2: 3
3: 17
4: 207
Right 1064569861 10:16681665-16681687 GAAACTTGAGCTGTGCAGATGGG No data
1064569859_1064569862 -2 Left 1064569859 10:16681645-16681667 CCTCAGAGATGATCTAGTTTGAA 0: 1
1: 0
2: 3
3: 17
4: 207
Right 1064569862 10:16681666-16681688 AAACTTGAGCTGTGCAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064569859 Original CRISPR TTCAAACTAGATCATCTCTG AGG (reversed) Intronic
901605578 1:10456368-10456390 TTCAGACTAGATCATGTCCAAGG + Intergenic
902406043 1:16184240-16184262 GTCAAACTGGCTCATCCCTGGGG - Intergenic
904143636 1:28372538-28372560 TTAAAACTAGAGCAATTCTGTGG - Intronic
905977106 1:42183813-42183835 GTCAGATTAGATTATCTCTGAGG - Intronic
907788714 1:57640209-57640231 GTTGAAATAGATCATCTCTGAGG + Intronic
908219840 1:61994032-61994054 TTTAAACTAGAGAATCTTTGTGG - Intronic
908632938 1:66130414-66130436 TTCAAATGAGATCATGTATGTGG - Intronic
909966117 1:81912592-81912614 CTCAAATTACATAATCTCTGTGG - Intronic
914232139 1:145772914-145772936 TTCAAACTATATAATTTCAGTGG + Intronic
916022561 1:160806840-160806862 TTCAAATTATTTCATCCCTGAGG - Intronic
917012788 1:170494041-170494063 GTCAAACTAGATGATCTCAAAGG - Intergenic
917017780 1:170554099-170554121 ATTAAATTAGATTATCTCTGAGG - Intergenic
924277564 1:242403874-242403896 TTTGAACTAGATGAACTCTGAGG + Intronic
1063021034 10:2127772-2127794 TCCAAAATAGATGCTCTCTGTGG + Intergenic
1063163746 10:3441237-3441259 GTTAGACTAGATCATCTCTAAGG - Intergenic
1063690002 10:8278042-8278064 TTAAAGCTAGATGATCTCTCAGG - Intergenic
1064569859 10:16681645-16681667 TTCAAACTAGATCATCTCTGAGG - Intronic
1066975576 10:42365360-42365382 ATAAAACTGGATCATATCTGAGG + Intergenic
1068097998 10:52516081-52516103 TTTTAACTAGAGCATCTGTGTGG - Intergenic
1068225865 10:54106318-54106340 TGCTAACTCCATCATCTCTGTGG - Intronic
1068719191 10:60223451-60223473 TTAACACTAGTTTATCTCTGAGG + Intronic
1068865294 10:61888939-61888961 GTTAAACTAGATGAGCTCTGAGG - Intergenic
1069907901 10:71742694-71742716 ATCAAATTAGCTCATGTCTGTGG + Intronic
1070585100 10:77758628-77758650 TTCAGAATAGATCATATCTCAGG + Intergenic
1070662904 10:78320273-78320295 TTTACTCTAGATCATCTCTAAGG + Intergenic
1072441958 10:95464858-95464880 GTCAAACTAGATCATTTCTAAGG - Intronic
1074234302 10:111569454-111569476 TTCAAACTGGAACATCCCTTAGG - Intergenic
1074459403 10:113623764-113623786 TTCAGACTACATGATTTCTGTGG - Intronic
1074633457 10:115286206-115286228 TTCTTACTAGCTCATCTTTGTGG + Exonic
1075402631 10:122172135-122172157 TACAATCTAGCTCATCTCTAGGG - Intronic
1076250597 10:128981123-128981145 ATCAAACAAGCTCCTCTCTGTGG + Intergenic
1076906600 10:133365470-133365492 TTAAAACTTGAGCATTTCTGAGG + Intronic
1078069282 11:8097755-8097777 TTCCAATTACCTCATCTCTGTGG + Exonic
1078325465 11:10377075-10377097 GACAAACTAGATGATCACTGAGG - Intronic
1080402114 11:31945953-31945975 TTTAGACTAGATTATCTCTGAGG + Intronic
1080480650 11:32646262-32646284 TACAAATTAGGTTATCTCTGAGG + Intronic
1080823034 11:35825046-35825068 TACAAACTAGATCTTTTCTCAGG + Intergenic
1081959284 11:47122443-47122465 TACATACTTGACCATCTCTGTGG + Intronic
1085336923 11:75703437-75703459 TTCAAACATGAACATCTTTGGGG + Intergenic
1086226410 11:84515813-84515835 TCCAAAATAGATCATGTGTGAGG + Intronic
1086424201 11:86668479-86668501 TCCAGACTAGATCATCTCTGAGG + Intronic
1087256133 11:95956204-95956226 TTCAAAATATAACATCTGTGTGG + Intergenic
1087648821 11:100840052-100840074 TTCAAATTAAATCATATCTAGGG + Intronic
1089379626 11:118018457-118018479 GTCAAAGAAGATCATCTCTGTGG + Intergenic
1091625683 12:2119178-2119200 GTTAGACTAGATCATCTCTAAGG + Intronic
1091858003 12:3754321-3754343 TTTACACTGGATAATCTCTGAGG - Intronic
1094181176 12:27593964-27593986 TTCCAACCTGATCCTCTCTGTGG - Intronic
1094650481 12:32371131-32371153 TTTAAAGTAAATCATCCCTGTGG - Intronic
1095364841 12:41390597-41390619 TTCTAACTTGATGATTTCTGGGG + Intronic
1097856338 12:64467499-64467521 TTCAAGTTAGATCTTCTCAGGGG - Intronic
1098209076 12:68143521-68143543 CTCAAACAAGATCCTTTCTGAGG - Intergenic
1099494290 12:83326665-83326687 TTCAAACTTGAGCATCTGTAGGG + Intergenic
1101167249 12:102051196-102051218 TTCAAACCAGATCCTGTCGGGGG + Intronic
1102000402 12:109554220-109554242 TTCAAATGAGATAATGTCTGTGG + Exonic
1108439947 13:50441328-50441350 TTCAAACTAAAACATCCTTGTGG + Intronic
1109259994 13:60134026-60134048 TTTAATCTGGATCATCACTGAGG - Intronic
1109849871 13:68048262-68048284 TTCTAATTATATCATCTCAGAGG - Intergenic
1113184155 13:107667542-107667564 TTCAAACTAAATGATTTCTAAGG + Intronic
1113986329 13:114319245-114319267 TTTAAAGTAGATGATCCCTGAGG + Intronic
1116043843 14:39718640-39718662 GGCAAACTAGGTGATCTCTGTGG + Intergenic
1117168458 14:53065690-53065712 TTTAAATTAGATCATTGCTGAGG - Intronic
1117870296 14:60193727-60193749 TTCAAATTATATCTTCTCTTTGG + Intergenic
1119702869 14:76767319-76767341 CTCCAACTAGATCATCACTATGG - Intronic
1119889129 14:78169603-78169625 GACAAACTAGTTCATGTCTGTGG - Intergenic
1121253459 14:92515393-92515415 ATCACACTAGGTCATCTCTGGGG - Intronic
1124991190 15:34675465-34675487 GTCCAACTTGATCATCTCTAAGG - Intergenic
1125589693 15:40846565-40846587 TTCACACAAGACCATCTCTCTGG + Intronic
1127895584 15:63295927-63295949 CTCAAATTAGCTCATCACTGTGG - Intronic
1128246454 15:66135919-66135941 GTCAGACTACATCATCTCTTGGG + Intronic
1128444388 15:67744078-67744100 ATTGAACTAGATCATCTCTGGGG + Intronic
1128915877 15:71562010-71562032 GTTAGACTAGATTATCTCTGAGG - Intronic
1128925664 15:71653030-71653052 TTCGAACTGGCTCATCTCTAAGG - Intronic
1130933754 15:88451303-88451325 TTCTAACTTGCTAATCTCTGGGG - Intergenic
1132447235 15:101935414-101935436 TTCAAATTCTATCAACTCTGGGG - Intergenic
1135064369 16:19296864-19296886 TTCAAACTAGATGATCATTGGGG - Intronic
1135465335 16:22679979-22680001 GACCAACTGGATCATCTCTGAGG + Intergenic
1135622041 16:23964248-23964270 TTCTATCTAGATCAGCGCTGTGG - Intronic
1135826451 16:25733038-25733060 TCCAAAGAAGACCATCTCTGAGG + Intronic
1136525172 16:30825084-30825106 TTCAAACGCCATCTTCTCTGAGG + Intergenic
1137663258 16:50228457-50228479 CTTAAACTAGAGTATCTCTGTGG - Intronic
1139034535 16:62927710-62927732 TTCAAACCATATAATCTATGTGG + Intergenic
1139755261 16:69137841-69137863 TTCAAACTGGATTTTGTCTGGGG - Exonic
1143991460 17:10966911-10966933 TTCAAACAAGATCACCTCTCTGG - Intergenic
1148184434 17:45631555-45631577 TGCTAACAAGATCACCTCTGGGG - Intergenic
1149634066 17:58152397-58152419 TCAAAACTAGAGTATCTCTGAGG + Intergenic
1149877709 17:60254389-60254411 TTCAAAGTATACCATCTCTCTGG - Intronic
1151041315 17:70863779-70863801 TCAAAACAAGATCATCTTTGAGG - Intergenic
1154382497 18:13865359-13865381 TCCATACTTGATCATCTCCGCGG - Intergenic
1155591728 18:27435207-27435229 GCCAAACTAGATTGTCTCTGTGG - Intergenic
1155821409 18:30382581-30382603 TTCAAACTGGATCCAATCTGAGG + Intergenic
1155849406 18:30752449-30752471 ATCAAACTACATTCTCTCTGGGG + Intergenic
1157429006 18:47608098-47608120 TTCAAACATGAACATCTTTGAGG + Intergenic
1158064710 18:53392726-53392748 TTCAAAATAAACCATCTCTATGG - Intronic
1158149757 18:54355310-54355332 TTTAAACTTGATCCTATCTGAGG - Intronic
1160083030 18:75748198-75748220 TTCTAACTAGATTATTTGTGGGG + Intergenic
1160388884 18:78515345-78515367 TTCAAACTTGATGATGTCTCAGG - Intergenic
1160638041 19:97119-97141 TTCAAATTCTATCAACTCTGGGG + Intergenic
1168008189 19:53507999-53508021 TTCAAACTAGAGACTGTCTGAGG + Intergenic
926558281 2:14386272-14386294 CTAACACTGGATCATCTCTGAGG - Intergenic
928631466 2:33197436-33197458 TTCAAACCCGAACATTTCTGTGG + Intronic
932695317 2:73951400-73951422 TTCAATCTAGACGATCTCTAAGG + Intronic
935455813 2:103266555-103266577 TTCAGACTAGAAAACCTCTGTGG + Intergenic
936717094 2:115200110-115200132 TTCAAACTAGATGAAGTGTGGGG - Intronic
940801319 2:158136338-158136360 TTCAAACTGAAGCCTCTCTGAGG - Intergenic
941270936 2:163427901-163427923 TTGAAAGTACATCATCTCTGTGG - Intergenic
941290922 2:163673664-163673686 TTAAAACTATATGCTCTCTGGGG + Intronic
942006909 2:171711606-171711628 TACAAAGTAGATCTTCACTGTGG + Intronic
942064755 2:172260231-172260253 TTCAACCTAGATCTTTACTGTGG + Intergenic
942078760 2:172381147-172381169 TGCAAACAAGCTCAGCTCTGGGG + Intergenic
945501911 2:210586393-210586415 TTCAAACTAAATCATTTCACAGG - Intronic
945805431 2:214484417-214484439 TTTGAACTAGATGTTCTCTGGGG + Intronic
946084830 2:217160235-217160257 ATTAAACTAGACAATCTCTGAGG - Intergenic
946105089 2:217362155-217362177 GTTGAACTAGATAATCTCTGAGG - Intronic
946764060 2:223023805-223023827 TTCAACCTGGATGATCTCAGTGG + Intergenic
946765279 2:223035153-223035175 TTCCCACTAGATGATCTGTGAGG + Intergenic
948008617 2:234632490-234632512 TTCAAAACAGATCCTCACTGTGG - Intergenic
1170781799 20:19431871-19431893 TTCAAGCTAAATGTTCTCTGTGG - Intronic
1172831766 20:37841892-37841914 TTAAAAAAAGATCAGCTCTGGGG + Intronic
1173707582 20:45123962-45123984 TTCAGACTAGGTGGTCTCTGAGG + Intronic
1179504858 21:41833647-41833669 TTGAAACTAGAACATCTCAGGGG + Intronic
950294628 3:11818277-11818299 TCCAAACTAGGTCACTTCTGAGG + Intronic
950444197 3:13026624-13026646 TATAAACTAGATCATTTCTCTGG + Intronic
951425188 3:22536516-22536538 TTTAGAATAGATCATCTCTAGGG + Intergenic
951666994 3:25137563-25137585 TTCAAACTTTAACATCTATGTGG - Intergenic
952763532 3:36935920-36935942 TTCAAACTAGATTATTTCACTGG + Intronic
952783170 3:37124560-37124582 GTCAGACTAGATGATCTCTAAGG - Intronic
953643651 3:44732779-44732801 TTCAAACTTGATAATCTCTGGGG + Intronic
953806177 3:46070197-46070219 TCCAAGATAGATCATCTGTGAGG - Intergenic
954129936 3:48555514-48555536 GTTAAACTAGATGTTCTCTGAGG + Intronic
954875649 3:53801400-53801422 TTCACACTGGACCTTCTCTGAGG - Exonic
957858753 3:85915826-85915848 TGAAAACAATATCATCTCTGTGG - Intronic
959622669 3:108415190-108415212 TCCACACTAGATTATCTCTGGGG - Intronic
960138978 3:114133998-114134020 TTCTAACTAGATTATTTCTTAGG + Intronic
960820781 3:121728831-121728853 ATTAAACTAGATTATCTCTAAGG - Intronic
961954218 3:130784208-130784230 TTTAAAATAGATGAACTCTGAGG + Intergenic
962164016 3:133030011-133030033 TTCTAACTAGTGCATCTTTGGGG + Intergenic
962444206 3:135450340-135450362 TTGGCTCTAGATCATCTCTGGGG + Intergenic
963806967 3:149732615-149732637 TATAAACTTGATCATCTGTGTGG + Intronic
965699381 3:171444005-171444027 TTCAAAATAGTTCTTCTATGAGG + Intronic
966287886 3:178319155-178319177 TTGAAGCTACAGCATCTCTGTGG - Intergenic
967407316 3:189132024-189132046 TTTTAACTAGATCATCTCCATGG + Intronic
967423095 3:189295403-189295425 TTTAAACTACATTATCTCTGTGG + Intronic
968323220 3:197790205-197790227 TTCAATTTAGAGCATCTCTTCGG + Intergenic
970653390 4:18202642-18202664 CTGAAAGAAGATCATCTCTGTGG + Intergenic
972147549 4:36046580-36046602 TTCAAAATAGATTCTTTCTGTGG - Intronic
972238317 4:37160440-37160462 TTTAAACTACAAAATCTCTGAGG - Intergenic
972714396 4:41631563-41631585 TTAAAACTATGTCATCTCTAGGG - Intronic
972811114 4:42586988-42587010 TTGGAACTAGATCATCACAGAGG - Intronic
975249451 4:72161222-72161244 TGCAAATTAGTTCAACTCTGTGG - Intergenic
975586539 4:75955670-75955692 TGCAAGCTAGATCATCCATGAGG - Intronic
976517325 4:85983873-85983895 ATAAAATTAGATCATATCTGAGG + Intronic
977543510 4:98347799-98347821 TTCAAAGTAGACCATCTTTTAGG + Intronic
981583608 4:146275342-146275364 TTCAGACTAGATGATCTCTGGGG - Intronic
982571882 4:157060623-157060645 TTGAAATTAGAGCATCCCTGGGG - Intergenic
982635308 4:157888124-157888146 TTTAAACTGGATGATCTCTCAGG + Intergenic
983018615 4:162646510-162646532 TTCATAATACATCATCTCTTTGG - Intergenic
983481182 4:168276342-168276364 TCCACACTTCATCATCTCTGTGG + Intronic
986616718 5:9624928-9624950 TTCAAACTTCAACATTTCTGAGG - Intergenic
986657018 5:10023672-10023694 TTCAAAATAGACCATATCTTAGG + Intergenic
987429777 5:17818526-17818548 TTCAAAGTAAATCACCTCTTGGG + Intergenic
989214472 5:38890571-38890593 TTCAAATTACAACAGCTCTGTGG - Intronic
989608722 5:43271307-43271329 TTCAAAGTCAGTCATCTCTGAGG + Intronic
991018168 5:61953423-61953445 TACAAAATAGATCATCATTGTGG - Intergenic
995339659 5:111043911-111043933 TTCAATCTAGATCTTATCTCTGG + Intergenic
997065873 5:130557686-130557708 TTGAAACTTGATCATCTTTGTGG - Intergenic
997476302 5:134144517-134144539 GTCAATCTGGCTCATCTCTGTGG - Intronic
999126528 5:149250271-149250293 TTGCAACTTGACCATCTCTGGGG - Intronic
1001173432 5:169443290-169443312 TTTGGACTAGATCATCTCTGAGG - Intergenic
1003243450 6:4364623-4364645 TTAAAACTAGATCATGTTTTGGG - Intergenic
1004418534 6:15447118-15447140 TTCAGATCAGATCATCACTGGGG - Intronic
1006140583 6:31927111-31927133 TTCCACCTAGATTATCTCTAGGG + Intronic
1006231235 6:32588729-32588751 TTCAAACTATATACTCTGTGTGG - Intronic
1008455577 6:51706993-51707015 TTCAAATTTGATTATCTGTGTGG + Intronic
1009711577 6:67328896-67328918 ATCAAACTAGATCATCGTTAAGG + Intergenic
1010238448 6:73594633-73594655 CTCAAACTTTAGCATCTCTGTGG - Exonic
1011940706 6:92838936-92838958 TTCAAAGTATTTCATCTCTTTGG - Intergenic
1012757199 6:103247329-103247351 TTCAAACTAGCTGATCTCATGGG - Intergenic
1013816126 6:114100419-114100441 TTTAAATCAGACCATCTCTGGGG - Intronic
1014777757 6:125529965-125529987 TGTGAACAAGATCATCTCTGAGG + Intergenic
1016290592 6:142524762-142524784 GGAAAACTAGATCTTCTCTGAGG + Intergenic
1017834768 6:158167753-158167775 TTCAATCTATTCCATCTCTGGGG + Intronic
1018499009 6:164382632-164382654 CTGAAACTAGATCCTCTCTTAGG - Intergenic
1019016098 6:168880553-168880575 TACAATCGAGATGATCTCTGCGG - Intergenic
1019218007 6:170455849-170455871 TCCACACCAGATCAGCTCTGTGG + Intergenic
1019443927 7:1061182-1061204 TGCAAACTGGCTCATTTCTGTGG + Intronic
1020938463 7:14499591-14499613 TTCAAACAAGATGATCTGTGAGG - Intronic
1026385687 7:69845483-69845505 TTCACACAAGAGCATCACTGTGG - Intronic
1030199816 7:106891200-106891222 ATCAAACTGGATAACCTCTGGGG + Intronic
1032168795 7:129566925-129566947 TTCAAATGTGAACATCTCTGTGG - Intergenic
1032794632 7:135267907-135267929 TTCAGCCTGGATCATCTTTGGGG + Intergenic
1034564131 7:151899845-151899867 TCCAAACTGGATCATCTGTCAGG + Intergenic
1036189873 8:6660533-6660555 TTCAGATTAGAACATCTTTGAGG + Intergenic
1040918503 8:52589033-52589055 TTCAGACTAGATAATTTCTATGG + Intergenic
1042640726 8:70931097-70931119 TTCAAAATAGTTCAACTATGTGG - Intergenic
1044496605 8:92894775-92894797 TGCAAACTAGATCGTCCCTGAGG + Intronic
1044534015 8:93339148-93339170 TTAAAACTAGGTCATCAGTGTGG - Intergenic
1045243923 8:100426390-100426412 ATCAAATTAGATCATAGCTGTGG + Intergenic
1046266259 8:111834849-111834871 TTCTAACTTGGACATCTCTGAGG - Intergenic
1047343412 8:124004468-124004490 TTCAATCTAGACACTCTCTGGGG + Intronic
1047996178 8:130338686-130338708 TTCAAACTACATGACATCTGTGG + Intronic
1048780825 8:137998873-137998895 TTCAAAATAGAGCATATTTGAGG + Intergenic
1049974687 9:850133-850155 TGCTAACCAGCTCATCTCTGTGG + Intronic
1055149578 9:72980141-72980163 GTGAAACTAGATGATCTCTAAGG - Intronic
1056205787 9:84318188-84318210 GTAAAACAAGAACATCTCTGGGG - Intronic
1056787186 9:89601828-89601850 TTTAGAATAGAGCATCTCTGAGG + Intergenic
1057940105 9:99274423-99274445 TTTGAACTAGATGATCTTTGGGG - Intergenic
1059398042 9:114051210-114051232 TGTAAACTAGCTCATCTCTGTGG + Exonic
1060096516 9:120795346-120795368 TCCAAACAATATTATCTCTGGGG - Intergenic
1060169003 9:121445161-121445183 TTCAGGCTAGATCATTTCTTTGG + Intergenic
1060230490 9:121821911-121821933 ATCAAACAAAATGATCTCTGAGG + Exonic
1060655398 9:125369190-125369212 GACCAACTAGATCATCTTTGGGG + Intergenic
1186474498 X:9846758-9846780 TTCAAAATGGCTCATCTCTGGGG - Intronic
1188346504 X:29072911-29072933 GGCAAACTAGACCATCTCTCTGG + Intronic
1190479559 X:50862414-50862436 TACAAACTAGAGTGTCTCTGGGG - Intergenic
1191130696 X:57006416-57006438 TTCAAAATAGATCATATATTAGG - Intergenic
1191690755 X:63935580-63935602 TCCAAACTAGATCATCTTCCTGG - Intergenic
1191844039 X:65533333-65533355 TTCAGACCAGGTGATCTCTGTGG - Intronic
1194853372 X:98897429-98897451 GTCAAATTACATAATCTCTGAGG - Intergenic
1196317868 X:114250542-114250564 TTCAAACTTAATCATCAATGTGG + Intergenic
1198028679 X:132734079-132734101 TCCATACTAGATCACCTCTTAGG + Intronic
1198276587 X:135099723-135099745 GTCACACTTGATCATCTCTATGG + Intergenic
1198376687 X:136047875-136047897 CTCACACTACATCATCTGTGTGG - Intergenic
1198880867 X:141279751-141279773 ATTAAACTAGTTGATCTCTGAGG - Intergenic
1199200484 X:145082137-145082159 TTGACACCAGATGATCTCTGAGG - Intergenic
1199294643 X:146143353-146143375 TCCAAATAAGATCATATCTGAGG + Intergenic
1199799296 X:151233691-151233713 TTTGAACTAGATTATCTCAGAGG - Intergenic
1201849714 Y:18465673-18465695 TTGAAATTAAAACATCTCTGTGG - Intergenic
1201883604 Y:18854702-18854724 TTGAAATTAAAACATCTCTGTGG + Intergenic