ID: 1064569867

View in Genome Browser
Species Human (GRCh38)
Location 10:16681683-16681705
Sequence ATGGGGAAGCTGAGGTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064569859_1064569867 15 Left 1064569859 10:16681645-16681667 CCTCAGAGATGATCTAGTTTGAA 0: 1
1: 0
2: 3
3: 17
4: 207
Right 1064569867 10:16681683-16681705 ATGGGGAAGCTGAGGTGGGTGGG No data
1064569858_1064569867 16 Left 1064569858 10:16681644-16681666 CCCTCAGAGATGATCTAGTTTGA 0: 1
1: 0
2: 2
3: 21
4: 158
Right 1064569867 10:16681683-16681705 ATGGGGAAGCTGAGGTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064569867 Original CRISPR ATGGGGAAGCTGAGGTGGGT GGG Intronic
No off target data available for this crispr