ID: 1064572123

View in Genome Browser
Species Human (GRCh38)
Location 10:16704618-16704640
Sequence ACAGAATTCTGGGCCCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 319}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064572123_1064572126 -2 Left 1064572123 10:16704618-16704640 CCTCACAGGGCCCAGAATTCTGT 0: 1
1: 0
2: 3
3: 22
4: 319
Right 1064572126 10:16704639-16704661 GTCATCAGAATCATTCCCTTTGG No data
1064572123_1064572127 -1 Left 1064572123 10:16704618-16704640 CCTCACAGGGCCCAGAATTCTGT 0: 1
1: 0
2: 3
3: 22
4: 319
Right 1064572127 10:16704640-16704662 TCATCAGAATCATTCCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064572123 Original CRISPR ACAGAATTCTGGGCCCTGTG AGG (reversed) Intronic
900184870 1:1328300-1328322 ACAGCAGTCTGGGCACTGTGGGG + Exonic
900820184 1:4880541-4880563 ACAGAAATCAGGGCCTGGTGAGG + Intergenic
901652597 1:10751800-10751822 ACAGCATCCTGTGCCCTGGGAGG - Intronic
902754571 1:18540541-18540563 ACAGAATACAGGGCCTGGTGTGG - Intergenic
903318801 1:22529299-22529321 ACTGAACTCTGGGGCCTTTGGGG + Exonic
904561562 1:31401549-31401571 GCACAATTCTAGGCCCTGGGAGG - Intergenic
904865449 1:33575323-33575345 ACAGAATTCTGGGCCAGGAAGGG - Intronic
906207471 1:43994928-43994950 ATAGACGTCTGGCCCCTGTGAGG - Intronic
906487944 1:46246248-46246270 AAAGAATTCTGGGCCGGGCGCGG - Intergenic
916489502 1:165289016-165289038 ACAGACTTCTGGCCCCTGCTGGG + Intronic
916695106 1:167227074-167227096 AAAGAAATCTGGGCCAGGTGTGG - Intronic
916741354 1:167649734-167649756 AGAAAATTCTTGTCCCTGTGAGG - Intronic
917837975 1:178955956-178955978 CCCGAATTCTCCGCCCTGTGAGG - Intergenic
918544148 1:185663538-185663560 ACAGACCTCTGGACCCTGTGGGG + Intergenic
921828745 1:219703288-219703310 ACAGCCTTCATGGCCCTGTGTGG + Intronic
922067670 1:222159406-222159428 ACAGAATTCTGCTTGCTGTGAGG - Intergenic
922577956 1:226675551-226675573 AAAGAACGCTGGGCCCAGTGAGG + Intronic
922889951 1:229054138-229054160 ACAGGGTTCCGGGCCCAGTGAGG + Intergenic
922994147 1:229942813-229942835 ACAGATTTCTGGGACAGGTGGGG - Intergenic
1064213534 10:13380953-13380975 ACAGAATTTTTGGCCAGGTGTGG + Intergenic
1064572123 10:16704618-16704640 ACAGAATTCTGGGCCCTGTGAGG - Intronic
1064773404 10:18749042-18749064 AAAGAATTTTGGGCCAGGTGTGG - Intergenic
1065434489 10:25692964-25692986 ACAGAGTTCTGGGGGCTGAGGGG + Intergenic
1067066786 10:43108532-43108554 ACAGAATTCTGGGCCATGACAGG - Intronic
1067494301 10:46748119-46748141 AAAGCCTTCTGGGCTCTGTGTGG + Intergenic
1067546059 10:47193373-47193395 TCAGAATTCAGGTCTCTGTGAGG + Intergenic
1067600358 10:47592278-47592300 AAAGCCTTCTGGGCTCTGTGTGG - Intergenic
1068132015 10:52906852-52906874 AGAGCATTCTGAGCTCTGTGAGG - Intergenic
1069290913 10:66778684-66778706 AAAAAATTCTGGGCCGAGTGCGG + Intronic
1069582673 10:69576279-69576301 AGAGAATTCTGGGACCTGCTTGG + Intergenic
1069924592 10:71839562-71839584 ATAGATTTCAGGGCCATGTGCGG + Intronic
1070715436 10:78717643-78717665 ACAGAATTTTGGGGCCAGTCTGG - Intergenic
1071323845 10:84491987-84492009 ATTGATTTCTGGGCCATGTGCGG + Intronic
1071651893 10:87400150-87400172 AAAGCCTTCTGGGCTCTGTGTGG - Intergenic
1072461492 10:95622825-95622847 AAAAAATTCTGGGCCGGGTGCGG - Intronic
1073127573 10:101161254-101161276 GGGGAATTCTGTGCCCTGTGTGG - Intergenic
1073154481 10:101335631-101335653 AAAGAATTTTGGGCCAGGTGTGG + Intergenic
1073233947 10:101997301-101997323 ACAAAATTCTGGGCCACGCGTGG + Intronic
1073291767 10:102416740-102416762 ACAGAGCTCTGGGCCCCGGGTGG + Exonic
1074671784 10:115799575-115799597 GCAGAATTCTGGGGCCTGGCTGG - Intronic
1075344644 10:121673299-121673321 ACAGCAGTCTGAGGCCTGTGGGG - Intergenic
1075412038 10:122235526-122235548 AAAAAATTCTGGGCCGTGTGCGG - Intronic
1075744990 10:124720907-124720929 TCAGAAATCTGGGCCGGGTGCGG + Intronic
1077260947 11:1619997-1620019 ACCCCATTCTGGGCTCTGTGTGG + Intergenic
1077704964 11:4475973-4475995 ACAGGAGTCAGGGCTCTGTGAGG - Intergenic
1077932790 11:6751669-6751691 ACAGAGTTCTGGACCTTATGAGG + Intergenic
1080575928 11:33599079-33599101 ACAGACTCCTGGCCCTTGTGGGG - Intronic
1083905241 11:65664831-65664853 ACAGAATTCTGGGCCAGGTGTGG - Intergenic
1084745366 11:71166771-71166793 AAAGAAGTGTGGGCCCGGTGTGG - Intronic
1087544284 11:99564376-99564398 ACAGAATTGTTGGCCAGGTGTGG - Intronic
1088254754 11:107892791-107892813 ATTGAATTCTGGGCCAGGTGCGG + Intronic
1088741319 11:112769669-112769691 ACACTATGCTGGGCACTGTGGGG + Intergenic
1089693324 11:120200014-120200036 CTTGAATGCTGGGCCCTGTGAGG - Intergenic
1090091943 11:123705646-123705668 ACTGAATTCAGGCCACTGTGTGG - Intergenic
1091015586 11:132048366-132048388 ATACATTTCTGGTCCCTGTGTGG + Intronic
1091733299 12:2897786-2897808 AAAAAATTCTAGGCCCAGTGCGG + Intronic
1091914723 12:4262559-4262581 ACAAATTTCTGGGCCCAGCGTGG - Intergenic
1092138625 12:6167316-6167338 AAAGAATCCTGGGCCCTGGAGGG - Intergenic
1094708894 12:32941511-32941533 AAAGAATTATGGGCCGGGTGCGG - Intergenic
1096170895 12:49468765-49468787 AAAAAATTCTAGGCCCAGTGTGG - Intronic
1096233668 12:49911515-49911537 ACACAAATCCCGGCCCTGTGGGG + Intergenic
1097456818 12:59809174-59809196 GCAGAATTCTGGGGCTTGTGAGG - Intergenic
1097964518 12:65564582-65564604 CCAAAATTCTGGGCCCACTGTGG - Intergenic
1098393963 12:69998526-69998548 AAGGATTTCTTGGCCCTGTGTGG - Intergenic
1099080854 12:78178449-78178471 ACAGTATTTTGGGCCAGGTGGGG - Intronic
1100917084 12:99436585-99436607 ACATTTTTCTGGGCACTGTGGGG - Intronic
1101444340 12:104726871-104726893 ACAGAATTCAGGGCCCTGAAAGG + Intronic
1102686116 12:114726090-114726112 ACAGAATTCTGTCCCTTGAGTGG - Intergenic
1102836799 12:116070639-116070661 ATATTATTCTGGGCACTGTGTGG - Intronic
1102916120 12:116753760-116753782 ACAGGATTTAGGTCCCTGTGGGG - Intronic
1103235163 12:119366570-119366592 ACAGAAAACTGTGCCCTGGGTGG + Intronic
1103618474 12:122170875-122170897 ACAGAAATCTGGGCTTTATGGGG - Intronic
1104828443 12:131731458-131731480 GCAGAATTTGGGGTCCTGTGTGG + Intronic
1105206247 13:18227398-18227420 ACAGAGTTCTTGGCCCTGCAGGG + Intergenic
1105400027 13:20083350-20083372 ATAGAAATCTGGGCCATGCGTGG - Intronic
1106297500 13:28429914-28429936 ACAGAGTTCTGAGCTCTCTGGGG + Intronic
1106971340 13:35145389-35145411 TTAGAAGTCTGGGCCCTGGGTGG + Intronic
1107665034 13:42679785-42679807 ACTGAATTTTTGGCCCTGTTGGG + Intergenic
1108518572 13:51224176-51224198 AAAGAATTCTTGGCCAGGTGCGG + Intronic
1110608037 13:77456418-77456440 ACAAAATGCTGGGGCATGTGAGG + Intergenic
1111936914 13:94567120-94567142 ACAAAATTATGGGCCAGGTGCGG - Intergenic
1112251041 13:97780663-97780685 ACATTACACTGGGCCCTGTGTGG - Intergenic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1115049334 14:29037744-29037766 TAAGATTTCTGGGCCCTGTTGGG + Intergenic
1116051983 14:39815010-39815032 ACAGGAGTGTGGGCCCTGTGAGG + Intergenic
1116810836 14:49538571-49538593 GCAGAATGCTGGGCCAGGTGTGG + Intergenic
1118158829 14:63268716-63268738 ACACAATTCTGTGCCCTGAAAGG + Intronic
1120877590 14:89388966-89388988 ACAGAAAACTGGGCCATCTGAGG + Intronic
1122018733 14:98819263-98819285 AGACAATTCTGGTCTCTGTGTGG - Intergenic
1122193676 14:100068479-100068501 AAATCACTCTGGGCCCTGTGTGG + Intronic
1122854423 14:104553316-104553338 ACACGATCTTGGGCCCTGTGGGG - Intronic
1123101123 14:105801820-105801842 AAAGCATTCTGGGCCCGGTGGGG + Intergenic
1125192992 15:37015191-37015213 GCAGAAATCTGTGCCCTCTGGGG - Intronic
1125477294 15:40055737-40055759 CCAGAGCCCTGGGCCCTGTGAGG - Intergenic
1125660541 15:41391327-41391349 ACAGAATTTAGGGCCAGGTGTGG + Intronic
1126120043 15:45243269-45243291 ATAGAACTCTGGGCCAGGTGTGG + Intergenic
1126380949 15:48046297-48046319 ACAGATTTCTGGGCCCCATTTGG - Intergenic
1127127443 15:55825708-55825730 ACAGACTTCTGGGCAGTTTGAGG - Intergenic
1127381154 15:58431539-58431561 ACAGAAATTTGGACCCTCTGGGG + Intronic
1128466284 15:67915184-67915206 ACAGAATTGTGAGCTCTGTCAGG - Intergenic
1128926294 15:71659331-71659353 ACATGATCCTGAGCCCTGTGAGG + Intronic
1129254682 15:74327342-74327364 ACAGAGCTCTGGGCCAGGTGCGG + Intronic
1129887661 15:79049760-79049782 ACAGATGTCTGGGGCCTGTCTGG - Intronic
1130183481 15:81654179-81654201 CCAGACTTCTGGGCCGGGTGGGG - Intergenic
1131525183 15:93146886-93146908 ACAGATTTCTGTTCCATGTGAGG - Intergenic
1132810740 16:1795425-1795447 ACAGAAAGCCAGGCCCTGTGCGG - Intergenic
1132818054 16:1844412-1844434 ACAGAATGCTTGGCCAGGTGTGG - Intronic
1134261052 16:12651086-12651108 ACACAAGTCTGGGCCCAGCGTGG + Intergenic
1135105030 16:19641917-19641939 AAAGAATTCTGGGCCAGGTGCGG + Intronic
1135380082 16:21988544-21988566 ACAGAATCCCAGGGCCTGTGAGG - Intronic
1135886702 16:26316642-26316664 ACAGCAATGTGGGCCCAGTGTGG + Intergenic
1135999378 16:27279761-27279783 AAACAATTCTGGGCCAGGTGCGG - Intronic
1136277048 16:29185034-29185056 CCAGAAAGCTGCGCCCTGTGGGG - Intergenic
1136481932 16:30547522-30547544 ACAGACCTCTGGGCCGGGTGTGG + Intronic
1137047404 16:35681253-35681275 AAACATTTCTGGGCCCTTTGAGG + Intergenic
1137747819 16:50835970-50835992 ACAGAAACCTGTGCCCAGTGGGG + Intergenic
1138598700 16:58042684-58042706 ACAGAAATCTGGCCCCGGAGTGG - Intronic
1140206897 16:72940459-72940481 ACAGAAGTCTGGGTTCTGGGTGG - Intronic
1140450256 16:75064927-75064949 CCAGTTTGCTGGGCCCTGTGAGG - Intronic
1140839978 16:78829509-78829531 TCAGATATCTGGGCACTGTGTGG + Intronic
1140929613 16:79615066-79615088 ACAGAAATCTGTTCCCTCTGGGG - Intergenic
1141010332 16:80391084-80391106 ACAGAATTCTCTGCCTTGGGAGG - Intergenic
1142016091 16:87748476-87748498 ACAGAAGCCTGGGCCGGGTGTGG - Intronic
1142273228 16:89101915-89101937 ACAGCAGGCTGGGCCCTGGGTGG + Intronic
1142366674 16:89653764-89653786 TCAGCAGTCTGAGCCCTGTGTGG + Intronic
1143481870 17:7231973-7231995 GCAGAATTTTGTGCCCAGTGAGG - Intronic
1143728364 17:8865677-8865699 ACAGAGCTCTGGGTCCTGAGGGG + Intronic
1144251930 17:13426224-13426246 AAAGAATTCTGGGCCGGGCGTGG + Intergenic
1144687461 17:17235706-17235728 TCAGAATTCTGGGCAGCGTGAGG + Intronic
1147276203 17:39318958-39318980 AAAGAATTCTGAGCCGGGTGTGG + Intronic
1147326973 17:39674297-39674319 ACAGAATTCAGAGCACAGTGTGG + Intronic
1148394706 17:47298813-47298835 AGAGAGTTTTGGGGCCTGTGAGG + Intronic
1149696044 17:58616873-58616895 ACACAATCCTGGGTGCTGTGGGG - Intronic
1149777378 17:59368726-59368748 ACAGAGTTCTGGATGCTGTGAGG + Intronic
1149955846 17:61048783-61048805 ACAGAATACTGGTGCCTCTGAGG + Intronic
1151552427 17:74829840-74829862 ACAGAATGCTGGGGTCTGTGTGG - Intronic
1152807836 17:82365408-82365430 AGAGAAATCTGGGGCCTCTGGGG + Intergenic
1155143353 18:23063362-23063384 ACAGAATAATTTGCCCTGTGTGG - Intergenic
1155211389 18:23605209-23605231 ACAGAATTCTGGGCCGGGCATGG - Intronic
1155487767 18:26365295-26365317 ACAGAATTATAGGCCAGGTGCGG - Intronic
1157701128 18:49762109-49762131 ATAGAATTCTGGGCACTGAGTGG - Intergenic
1159998772 18:74995293-74995315 ACAGCATTCTGGATGCTGTGTGG + Intronic
1160034616 18:75288466-75288488 ACAAAACTCTGGGCCCACTGGGG + Exonic
1160311720 18:77798403-77798425 ACAGAATTCTAGGTCAGGTGTGG - Intergenic
1162941256 19:14010971-14010993 AAAGAATTCAGGGCCTGGTGCGG - Intergenic
1163500320 19:17672411-17672433 ACACAATGGTGGGCACTGTGTGG - Exonic
1163670478 19:18625009-18625031 GTATCATTCTGGGCCCTGTGTGG + Intergenic
1164211737 19:23104018-23104040 ACAGGATTCAGGGCCGGGTGTGG + Intronic
1166827696 19:45619563-45619585 TCAGACTTCTGGGCTCTGTCTGG - Intronic
1168200680 19:54813252-54813274 AGAGAACTCAGGGCCCTGTGCGG + Intronic
1168264979 19:55217819-55217841 CCAGGAATCTGGGCGCTGTGTGG + Intergenic
924970423 2:121906-121928 ACAGAAATCAGGGCACTGTTGGG + Intergenic
925607796 2:5676330-5676352 ACAGAATTATGAGTTCTGTGAGG + Intergenic
926508575 2:13745392-13745414 TCAGCTTTCTGGGCTCTGTGGGG - Intergenic
928029094 2:27763793-27763815 ACAGAACTCATGGCCATGTGAGG - Intergenic
928047674 2:27953580-27953602 AGAGAAGTGTGGGCCCAGTGCGG - Intronic
928675696 2:33648857-33648879 AGAGAAGTTTGGGCTCTGTGTGG + Intergenic
929696345 2:44119491-44119513 AAAGAGTTCTGGGCCAAGTGTGG + Intergenic
929901432 2:46007113-46007135 ACACAAATCTGGGCCCTCTCTGG - Intronic
930982548 2:57545191-57545213 TCAGAAATCTGGGTCCTTTGAGG + Intergenic
931688652 2:64816493-64816515 ACTGGATGCTGGGGCCTGTGTGG - Intergenic
931848198 2:66226162-66226184 ACAGAATTTCGGGCCCAGAGAGG - Intergenic
931864752 2:66397385-66397407 ACAGATTTCAGGGCCCTATCTGG - Intergenic
937468915 2:122158543-122158565 ACAGCATTCTTCACCCTGTGGGG - Intergenic
937826021 2:126369280-126369302 GCAGATATCTGGACCCTGTGAGG + Intergenic
942876424 2:180805076-180805098 ACTGAATCCTAGGGCCTGTGTGG - Intergenic
945946333 2:215999265-215999287 ACAGGATTTTGAGCCCTGTCAGG + Intronic
946765130 2:223033455-223033477 AGAGCTTTCTGGGCCATGTGGGG + Intergenic
948262334 2:236613498-236613520 GCAGTGTTCTGGGTCCTGTGGGG - Intergenic
1169331322 20:4718743-4718765 ACATAATGCTGGGCCGGGTGTGG + Intergenic
1169394998 20:5221354-5221376 CAAGAACTGTGGGCCCTGTGTGG + Intergenic
1169746680 20:8950430-8950452 ACAGAGTTCTGGTCCTTATGTGG - Intronic
1171136153 20:22696398-22696420 AGAGGACTCTGGGCCCTCTGTGG + Intergenic
1171294628 20:24006481-24006503 ACAAAATGCTGGGCTGTGTGTGG - Intergenic
1171537549 20:25909204-25909226 ACAATAATCTTGGCCCTGTGCGG + Intergenic
1171982213 20:31636169-31636191 ACAGAATTGTAAGCCCTGTGGGG + Intergenic
1174818806 20:53709996-53710018 ATAGAATTCTGGGCTGGGTGTGG - Intergenic
1175313302 20:58026622-58026644 GCAGAAATGTGGGCCCAGTGAGG + Intergenic
1175421296 20:58835731-58835753 ACACTATTCCGGGCACTGTGGGG - Intergenic
1175438984 20:58977506-58977528 GAAGAATTCTGGGCCGGGTGCGG - Intergenic
1180144660 21:45912582-45912604 ACAGGGTGCTGGGCCCTGGGTGG - Intronic
1180759707 22:18191307-18191329 ACAGAGTTCTTGGCCCTGCAGGG - Intergenic
1180770020 22:18375608-18375630 ACAGAGTTCTTGGCCCTGCAGGG - Intergenic
1180775961 22:18433393-18433415 ACAGAGTTCTTGGCCCTGCAGGG + Intergenic
1180776308 22:18487058-18487080 ACAGAGTTCTTGGCCCTGCAGGG + Intergenic
1180809034 22:18744429-18744451 ACAGAGTTCTTGGCCCTGCAGGG + Intergenic
1180827960 22:18878563-18878585 ACAGAGTTCTTGGCCCTGCAGGG - Intergenic
1180911511 22:19454116-19454138 ACAGAACTGTGTGCCCTGGGTGG - Intronic
1181032390 22:20154821-20154843 TCAGCATCCTGGCCCCTGTGGGG - Intergenic
1181071957 22:20349405-20349427 ACAGAGTTCTTGGCCCTGCAGGG + Intergenic
1181195030 22:21178350-21178372 ACAGAGTTCTTGGCCCTGCAGGG + Intergenic
1181214415 22:21314424-21314446 ACAGAGTTCTTGGCCCTGCAGGG - Intergenic
1181287991 22:21768248-21768270 AAAGAATTGTGGGCCAGGTGCGG - Intronic
1181511024 22:23388775-23388797 TCAGCATCCTGGCCCCTGTGGGG + Intergenic
1181821175 22:25476937-25476959 GCAGAATTCAGAGCCCAGTGTGG + Intergenic
1182307899 22:29383823-29383845 GATGAATTCTGGGCCTTGTGGGG + Intronic
1182599110 22:31445997-31446019 ATAAAATTCTGGGCCAGGTGCGG + Intronic
1182811606 22:33121649-33121671 GCAGAAATTTGGGCCTTGTGGGG + Intergenic
1183201622 22:36388524-36388546 ACATAATTATGATCCCTGTGGGG + Intergenic
1183290666 22:36999908-36999930 ACAGGATTCTGGGTCCTGCTGGG + Exonic
1183539482 22:38421569-38421591 ACAGAATTCTGGGCTCTGTCTGG - Intergenic
1183980007 22:41533811-41533833 ACTGAATGTTGGGCCATGTGGGG - Intronic
1184512676 22:44942604-44942626 ACAGACCTCGGTGCCCTGTGTGG - Intronic
1184709887 22:46243388-46243410 AGAGGATGCTGGGGCCTGTGTGG - Exonic
1185017618 22:48353870-48353892 ACAGAACTCTGTGCCCTGCAGGG + Intergenic
1203231851 22_KI270731v1_random:116792-116814 ACAGAGTTCTTGGCCCTGCAGGG - Intergenic
1203278059 22_KI270734v1_random:104562-104584 ACAGAGTTCTTGGCCCTGCAGGG - Intergenic
950006251 3:9692914-9692936 ATAGAATCCTGGGCTCTGAGGGG - Intronic
950396870 3:12740409-12740431 AAAGCATTCTGGGCCAGGTGTGG + Intronic
950457368 3:13100664-13100686 CCAGAATTCTGGGCCACGTCAGG + Intergenic
950749686 3:15118869-15118891 AAAGAATTCTGGGCCGGGCGCGG + Intergenic
951483056 3:23182207-23182229 AGAGTATTCTGGGCCAGGTGCGG - Intergenic
951531053 3:23698399-23698421 ACAAATTTCTGGGCCAGGTGCGG + Intergenic
951683500 3:25319593-25319615 ACGGAATTCTTAGGCCTGTGAGG - Intronic
953296877 3:41727746-41727768 ACAGCATTCTGGATCCTGTGAGG + Intronic
953447824 3:42982770-42982792 ACAGCACGCTGGGCCCTGGGAGG - Intronic
953662836 3:44903673-44903695 ACACAACTCTGTGCCCTGGGAGG + Intronic
953662916 3:44904030-44904052 ACAGAACCCTGGGCCATGTAAGG - Intronic
955643734 3:61114222-61114244 ACAGAATTCTCAGTCCTCTGAGG + Intronic
956746928 3:72317841-72317863 AAAGAAATGTGTGCCCTGTGGGG - Intergenic
959315973 3:104807163-104807185 TCTGAATGCTAGGCCCTGTGTGG + Intergenic
960944188 3:122954762-122954784 AGAAAAATATGGGCCCTGTGGGG + Intronic
961569096 3:127785413-127785435 ACTGGATGCTGGGCACTGTGTGG + Intronic
962417843 3:135200118-135200140 ACATAATTCTCAGCCCTTTGGGG + Intronic
962430060 3:135310900-135310922 ACAGTATTCTTGGCCCAGCGAGG + Intergenic
964736710 3:159925618-159925640 ACACAGTCCTGGGCCCTTTGGGG - Intergenic
966899607 3:184470823-184470845 AAAGAATTCTGGGCTGGGTGCGG + Intronic
969131595 4:4994657-4994679 ACAGGCATCTGGGCGCTGTGTGG + Intergenic
969278954 4:6156426-6156448 TCAGAATTCTGGACTCTGTTAGG - Intronic
969616237 4:8254344-8254366 ACAGAATACTGCGGCCTGGGTGG + Intergenic
970344659 4:15141937-15141959 AAGAAATTCTGGGACCTGTGGGG + Intergenic
974139514 4:57866677-57866699 ACAGAAGCCTGTGCACTGTGAGG + Intergenic
974877804 4:67718984-67719006 CCAGAATGCTGGTCACTGTGTGG + Intergenic
975128627 4:70810068-70810090 AAAGAATTATTGGCCCCGTGTGG + Intergenic
981448677 4:144870348-144870370 ACAGAATTGTGGGGTCTCTGAGG + Intergenic
981475779 4:145185252-145185274 AAAGAATTATGGGCCAGGTGTGG - Intergenic
982043735 4:151420879-151420901 AGAGAGCTCTGGGTCCTGTGGGG - Intronic
982318776 4:154058241-154058263 ACAGCCTTCTGGCCCCTCTGGGG - Intergenic
982544165 4:156711979-156712001 ACAGAAATCTGGTCCCTTGGGGG + Intergenic
982825723 4:160001872-160001894 ACAGCTTGCTGGGCTCTGTGGGG - Intergenic
983228670 4:165108621-165108643 GCAGTATTCTTGGCCCTGTATGG + Intronic
984803396 4:183734387-183734409 AAAGAATTCAGGGCCCGGAGTGG - Intergenic
985653090 5:1116051-1116073 GCAGAATTCTCGGCCCTGGTGGG - Intergenic
985875051 5:2587861-2587883 TCAGAAGTCTGGGCACGGTGTGG - Intergenic
987116778 5:14731994-14732016 ACAGAAACCTGGGTCCTGTGGGG - Intronic
988364145 5:30273968-30273990 ACAGAATACTAGTCCTTGTGGGG + Intergenic
988505545 5:31819364-31819386 CCAGAATTCTGGGCTGGGTGTGG + Intronic
989666115 5:43856450-43856472 ACACAATTCTTGGCTCTTTGTGG + Intergenic
992285523 5:75231364-75231386 AAGGAATTCTGGGCCAGGTGTGG - Intronic
992665618 5:79005961-79005983 GCATAATGCTAGGCCCTGTGTGG + Intronic
994044516 5:95292981-95293003 TCAGAAGTCTGGGCACAGTGTGG + Intergenic
994426342 5:99592810-99592832 AGAGATTTCAGGACCCTGTGAGG + Intergenic
995007666 5:107219807-107219829 ACAGAATACTAGGTTCTGTGGGG - Intergenic
997633972 5:135390864-135390886 ACAGAATTCTGGGCACTCTGGGG + Intronic
998805243 5:145912222-145912244 ACTGGACTCTGGGCTCTGTGGGG - Intergenic
999689621 5:154135381-154135403 AACAAATTCTGGGCCCTGTTTGG - Intronic
999808005 5:155101832-155101854 TCACGATTCTGGGCCCTCTGTGG + Intergenic
999969225 5:156842473-156842495 ATGGAATTCTGGGGCCAGTGGGG - Intergenic
1000256094 5:159540130-159540152 ACAGATTTCAGGGCCAGGTGCGG + Intergenic
1002596403 5:180326646-180326668 ACATAGTTCTGGGGCCAGTGGGG + Intronic
1002906169 6:1450950-1450972 AGAGAAGTCTGAGCTCTGTGAGG - Intergenic
1003135703 6:3433360-3433382 AGAGAGTTGTGGCCCCTGTGTGG - Intronic
1003164699 6:3665950-3665972 CTGGACTTCTGGGCCCTGTGGGG - Intergenic
1004337930 6:14781597-14781619 ACAGAGTACTGGGTCCTGTTAGG - Intergenic
1004712292 6:18183548-18183570 ACAAAATTCAGGGCCCGGCGTGG - Intronic
1005671168 6:28107726-28107748 GGAGACTCCTGGGCCCTGTGAGG + Intergenic
1006680688 6:35795107-35795129 ACAGCATTCTGGGCTAGGTGTGG + Exonic
1007884537 6:45211558-45211580 AGAGAATTCTGGGCCAGGCGTGG + Intronic
1009245875 6:61237108-61237130 ACAGAATTCTTTTCCCAGTGAGG + Intergenic
1010785649 6:79997231-79997253 ACAACATTCTGGGCCAGGTGAGG + Intergenic
1012256634 6:97040512-97040534 ACAGATTGCTGGGCCCTGCTTGG + Intronic
1014251918 6:119123623-119123645 ACAGAGTTCTCGGCCCTGATGGG - Intronic
1014461258 6:121698515-121698537 CCCTAATTCTGGGACCTGTGGGG + Intergenic
1015314685 6:131805406-131805428 ACAGGATTGTGTGCCCAGTGTGG - Intergenic
1016578563 6:145600883-145600905 TCAGAACTCTGTGCCCTCTGAGG - Intronic
1017635019 6:156435322-156435344 GCAGATTCCTTGGCCCTGTGCGG - Intergenic
1017894287 6:158665817-158665839 ACAGAAGTTTGGGCCAAGTGTGG + Intronic
1018156446 6:160989923-160989945 AAAGAAATCTGGGGGCTGTGAGG + Intergenic
1018848907 6:167573689-167573711 ACAGAATCCCAGGCCCCGTGTGG + Intergenic
1019094986 6:169572248-169572270 AAAGAATTCTGGGCCGGGCGTGG + Intronic
1020514255 7:9096538-9096560 ACAGACTTCTGAGCAGTGTGAGG - Intergenic
1021573105 7:22084626-22084648 GCAGATTCCTGGGCCCTGTTTGG + Intergenic
1022162849 7:27728853-27728875 ACATACTTCTGGGCCGGGTGCGG - Intergenic
1022309564 7:29183665-29183687 AAAAAATTCTGGGCCAGGTGTGG - Intronic
1022518874 7:30993035-30993057 ACAGATCTCTGGACCTTGTGAGG + Intronic
1023249803 7:38245994-38246016 AAAGAATTCTTGGCCGAGTGTGG - Intergenic
1023251179 7:38262947-38262969 AAAGAATTCTTGGCCGAGTGTGG - Intergenic
1024038782 7:45533250-45533272 ACACCATGCTTGGCCCTGTGGGG + Intergenic
1024285653 7:47755345-47755367 ACAGAATCATGGGCCAGGTGAGG - Intronic
1024452574 7:49564266-49564288 ACCGACTCCTGGGCCATGTGGGG - Intergenic
1025796671 7:64744486-64744508 AAAGAATTCAGGGCCGGGTGTGG + Intergenic
1025989622 7:66486494-66486516 ACAGAATTCCTGGCCTTGAGAGG - Intergenic
1028003309 7:85529412-85529434 TCAGAAATCTGGGCACAGTGTGG - Intergenic
1031875700 7:127138377-127138399 ACAGGTTTCTGGACCCTGTGTGG - Intronic
1032071998 7:128813688-128813710 AAAGAATTCTAGGCCAGGTGCGG + Intronic
1032545655 7:132739639-132739661 TCAGAATTCTCTTCCCTGTGAGG + Intergenic
1032975021 7:137212455-137212477 ACAGAATTCTAGGACATGTAAGG - Intergenic
1034730656 7:153384852-153384874 ACAAAAATCTGTGCCCTGTGGGG + Intergenic
1035682861 8:1501209-1501231 ACAAAATGCTGGGCTCTGAGCGG + Intergenic
1038024791 8:23578727-23578749 CCAGAATTATGTGCCCAGTGAGG + Intergenic
1038395735 8:27244219-27244241 AAAGACTTCTGGGGCATGTGCGG - Intronic
1038642669 8:29340203-29340225 ACAGAATTCTGGGTACTCGGAGG + Exonic
1038958067 8:32488774-32488796 ACAGATTTCTGTGCCATCTGAGG - Intronic
1042148818 8:65759577-65759599 TCAGCATTCTGGGCCCTGATTGG - Intronic
1042269918 8:66944200-66944222 ACATACTTCTTGGCCCTGGGAGG + Intergenic
1044700624 8:94962581-94962603 ACAGAAGTCTGGGCTAGGTGTGG - Intronic
1046841079 8:118857836-118857858 ACAGAATTCTGAGTTCTGTGTGG + Intergenic
1047095094 8:121616524-121616546 AGAGAATTCTTGGACCTGGGAGG - Intronic
1048375514 8:133819254-133819276 ACAGATTCCTGGGCCCTCTGAGG - Intergenic
1048838971 8:138547903-138547925 ACAGACTTCAGGGCATTGTGTGG - Intergenic
1049954834 9:682954-682976 ACAGAACTCTGAGCCCACTGCGG + Intronic
1049955899 9:692722-692744 AAAAAATTCTGGGCCATGTGTGG + Intronic
1050304468 9:4294216-4294238 ACAGAATAATGGGCCAGGTGCGG + Intronic
1051528396 9:18073247-18073269 CTTGAATTGTGGGCCCTGTGAGG + Intergenic
1052419540 9:28224352-28224374 AAAAAATTCTGGGCCAGGTGCGG - Intronic
1052723343 9:32199593-32199615 TCAGAAGTCTGGGTCCTATGTGG + Intergenic
1053214597 9:36259950-36259972 AAAGAAATCTGGGCCTGGTGTGG - Intronic
1053296099 9:36913829-36913851 ACAGCACTCTGGGCTTTGTGGGG + Intronic
1054848775 9:69824260-69824282 AAAGAATTCTGTTTCCTGTGGGG - Intronic
1056102202 9:83310742-83310764 AAATAATTCTGAGCTCTGTGCGG - Intronic
1056487714 9:87075752-87075774 GCAGCCTTCTGGACCCTGTGGGG - Intergenic
1056530371 9:87481483-87481505 AAAGAAAGCTTGGCCCTGTGTGG + Intergenic
1056852362 9:90095373-90095395 ACACACTTCTGGGCCTTATGTGG + Intergenic
1057706553 9:97399062-97399084 ACAGCATGCTGGGCCCACTGGGG + Intergenic
1059106360 9:111515147-111515169 ACAGCAGTCTGAGCACTGTGAGG + Intergenic
1060212163 9:121717232-121717254 GCAGAATTCTGGACTCTGAGTGG + Intronic
1060926981 9:127461918-127461940 ACAGCATGAGGGGCCCTGTGCGG + Intronic
1061647212 9:132013913-132013935 AAATAATTCTGGGCCGGGTGTGG + Intronic
1203611529 Un_KI270749v1:10922-10944 ACAATAGTCTTGGCCCTGTGCGG - Intergenic
1185566287 X:1097829-1097851 GCAGAATCCTGGGTCCTGGGAGG + Intergenic
1186875519 X:13812774-13812796 AAAGAATTCTGGGCCATTTCTGG - Intronic
1187134355 X:16532443-16532465 ACAAAATTGTGTGCCCTTTGAGG - Intergenic
1187338994 X:18404735-18404757 ACACAATTCAGGGCCAGGTGTGG + Intergenic
1188183297 X:27082520-27082542 ACAAAAATCTGGGCCAGGTGCGG - Intergenic
1188539938 X:31238558-31238580 ACAGAACTCAGGGCCTTGTAAGG - Intronic
1190734042 X:53243502-53243524 ACATAATTATGGGCACTGGGTGG + Intronic
1192359041 X:70426858-70426880 GCAGAATCTTGGGACCTGTGGGG - Exonic
1193325891 X:80178336-80178358 ACAGAGATCTGGGCCTTGTTGGG - Intergenic
1194052877 X:89093819-89093841 GCAGTATTATGGGCCTTGTGAGG + Intergenic
1196567499 X:117226607-117226629 TTAGAATTCTGGGCCCTTGGTGG - Intergenic
1197740832 X:129892311-129892333 ATAGAATTCTGGGCCAGGTGTGG - Intergenic
1198328354 X:135596604-135596626 ACCGAACTCTGGGATCTGTGTGG + Intergenic
1200820534 Y:7578084-7578106 ACAAAATTCTGGGCACCTTGTGG - Intergenic
1201230880 Y:11863134-11863156 ACAAAATTCTGGGCACCTTGTGG - Intergenic
1201955467 Y:19617962-19617984 ACAGAGATCTGGGCCTTGTGGGG - Intergenic