ID: 1064574634

View in Genome Browser
Species Human (GRCh38)
Location 10:16731885-16731907
Sequence TAAGCCGATATTGTTGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064574631_1064574634 2 Left 1064574631 10:16731860-16731882 CCAACGCTTTTGAGAGTGGTTAA 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1064574634 10:16731885-16731907 TAAGCCGATATTGTTGGGACAGG No data
1064574629_1064574634 12 Left 1064574629 10:16731850-16731872 CCATTTATCTCCAACGCTTTTGA 0: 1
1: 0
2: 0
3: 11
4: 161
Right 1064574634 10:16731885-16731907 TAAGCCGATATTGTTGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064574634 Original CRISPR TAAGCCGATATTGTTGGGAC AGG Intronic
No off target data available for this crispr