ID: 1064581398

View in Genome Browser
Species Human (GRCh38)
Location 10:16796527-16796549
Sequence GTGGGAGCTCTGATAAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064581398 Original CRISPR GTGGGAGCTCTGATAAGAGG GGG (reversed) Intronic
900776118 1:4586696-4586718 GTGTGAGCTCAGTGAAGAGGAGG + Intergenic
901882446 1:12202160-12202182 CCGGGAGCTCAGGTAAGAGGTGG + Exonic
901886816 1:12229608-12229630 GTGGCAGCTCTGTAAGGAGGTGG + Intergenic
904254255 1:29244416-29244438 GTGGGTGATAAGATAAGAGGTGG + Intronic
905381668 1:37566094-37566116 GTGGAAGCTCTGCTAAGGAGAGG - Exonic
907484584 1:54768402-54768424 GTGAGAGCTCAGATTGGAGGAGG + Intergenic
912171423 1:107104780-107104802 GTAGGAGCGCTGATAACAAGAGG - Intergenic
912864414 1:113244597-113244619 GTTGGAGCTCTTACAGGAGGAGG + Intergenic
917704517 1:177618547-177618569 CTGGTTGCTCTGATAAGAGAAGG + Intergenic
918972655 1:191439814-191439836 GTAGGATCTATCATAAGAGGCGG - Intergenic
920121927 1:203665263-203665285 GTAGCAGCTCTGAAAAGAGAAGG + Intronic
920185103 1:204154614-204154636 GTGGGAAGTCTGAAAAGAGCCGG - Intergenic
920245149 1:204582295-204582317 GAGGCAGCCCTGAAAAGAGGAGG - Intergenic
920580337 1:207100908-207100930 ATGAGAGCTCAGATGAGAGGAGG + Intergenic
923875801 1:238045718-238045740 GTGGGAGCTAAGCTATGAGGAGG + Intergenic
1063035600 10:2284069-2284091 GAGGGAGCTCTCAGAGGAGGAGG - Intergenic
1063495484 10:6503660-6503682 GTGGGAGATATGGAAAGAGGAGG - Intronic
1064377082 10:14806702-14806724 GTGGCAGCTGTGATCAGTGGAGG - Intergenic
1064581398 10:16796527-16796549 GTGGGAGCTCTGATAAGAGGGGG - Intronic
1064851527 10:19714237-19714259 GTGGTAGCTCTCAGAAGACGGGG + Intronic
1068102290 10:52570646-52570668 GTGGCAGCTCTCAGAATAGGAGG - Intergenic
1069887221 10:71631422-71631444 GAGGGAGCACTGATGACAGGAGG + Intronic
1071432829 10:85619636-85619658 GTGGGATCTCTGATAGGAGCAGG - Intronic
1071474802 10:86016901-86016923 GAGGGTGCTCTGATAAGAGGAGG + Intronic
1071877948 10:89862751-89862773 GTGGGAGCTAAGCTATGAGGAGG - Intergenic
1072191525 10:93080353-93080375 ATGGGAGCGCTGAGAGGAGGTGG + Intergenic
1074743895 10:116511762-116511784 GTGGAAATTCTGATAAAAGGGGG - Intergenic
1074871676 10:117581873-117581895 GTTGGATCTCTGAAAAGAAGTGG + Intergenic
1078080628 11:8202199-8202221 ATGGAAGCTCAGAAAAGAGGAGG + Intergenic
1079085573 11:17442639-17442661 GTCAGAGCTCGGGTAAGAGGGGG - Intronic
1079367171 11:19819508-19819530 GGGGGAGTTCTGCTAAGTGGAGG + Intronic
1080338285 11:31225306-31225328 GTGGGAGCTAAGCTATGAGGAGG + Intronic
1080863350 11:36170075-36170097 GTGGGAGCTAAGCTATGAGGAGG - Intronic
1083191520 11:61055804-61055826 GTGGGAGATATGATAAGGTGGGG + Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1084409643 11:68999233-68999255 ATTGGAGTCCTGATAAGAGGAGG + Intergenic
1086322346 11:85664318-85664340 GTGGCAGCGCCGAAAAGAGGCGG - Exonic
1086630610 11:89014529-89014551 GTGGGGGCTCTGGGAAGTGGAGG + Intronic
1086940331 11:92790918-92790940 GTGGGGGCTCTGACAGGAAGTGG - Intronic
1087141990 11:94773559-94773581 GTGGGTGCTCTGAGGAGAGAGGG + Intronic
1088700349 11:112406051-112406073 GTGGGTGCGATGAAAAGAGGAGG + Intergenic
1088794551 11:113256712-113256734 GTGGGGGTTGTGATAAAAGGTGG - Intronic
1089033032 11:115353690-115353712 GTCAGAGCTCTGATAAAAGCTGG - Intronic
1091335958 11:134765940-134765962 GTGGGTGCTTAGATAAGGGGAGG + Intergenic
1092310811 12:7350025-7350047 CTGGGAGCTCAGAGAAGAGAAGG - Intronic
1092456673 12:8649986-8650008 GTGGGAGCTAAGCTATGAGGAGG - Intronic
1093879220 12:24384287-24384309 ATGGCTGCTCTGATAGGAGGCGG + Intergenic
1096254910 12:50057048-50057070 GTGGGAGCAGGGATAAGAGCAGG + Intergenic
1096671187 12:53199143-53199165 GTGGGAGCCCAGATAAGAGATGG - Intronic
1098251297 12:68572245-68572267 ATGGGAGCTGTGATCAGAGAAGG - Intergenic
1103429705 12:120872699-120872721 GTGGGAGCTCTGGGAAGTGTTGG - Intronic
1105800061 13:23895102-23895124 GTGGGACCTCTGAATGGAGGGGG + Intronic
1105848971 13:24317897-24317919 GTGGGACCTCTGAATGGAGGGGG - Intronic
1109249872 13:60006664-60006686 GGGGGAGCTCAGAGATGAGGTGG + Intronic
1112034286 13:95483245-95483267 GTGGGCTCTCTGAGAAGATGGGG + Intronic
1112132739 13:96541592-96541614 CTGGGAGCTATGATTACAGGTGG + Intronic
1118833349 14:69456478-69456500 GTGAGAGCTGGGAGAAGAGGAGG - Intronic
1119499259 14:75109541-75109563 ATGGAAGCTCTTATAAGAGCAGG - Intronic
1121179597 14:91918930-91918952 TTGGGAACTCAGAGAAGAGGAGG + Intronic
1123024303 14:105417268-105417290 GTGGGAGCATTGCTGAGAGGTGG - Intronic
1129839183 15:78733175-78733197 GTGGGAGCACAGATAGGAAGGGG - Intergenic
1129879971 15:78999905-78999927 GTGGGAACTCTGCAGAGAGGAGG + Exonic
1130938348 15:88488620-88488642 AAGTGAGCTCTGATTAGAGGAGG - Intergenic
1131070324 15:89461765-89461787 GTGGGAGCTCTGTTTAGGGTGGG - Intergenic
1131510469 15:93047152-93047174 GTGGGAGGCCTGAGAGGAGGAGG + Intronic
1135838429 16:25850602-25850624 GTGGGAGCTTGGAGAATAGGAGG - Intronic
1138547331 16:57727674-57727696 GTGGGAGCCCTGAGTAGAGGTGG - Intronic
1140941670 16:79726855-79726877 GTGAGAGCTCTAAGAAGAGAGGG - Intergenic
1142716044 17:1747520-1747542 GTGGGGGATCTGAGAGGAGGAGG - Intronic
1143674503 17:8422078-8422100 GTGGGAGCCCTGAGAAAAGGTGG + Intronic
1144161247 17:12560974-12560996 GTGGGAGCTAAGCTATGAGGAGG - Intergenic
1146748713 17:35355886-35355908 GTGGGAGCTCTGAGGACAGAAGG - Intronic
1147637764 17:41974376-41974398 GTGGTGGCTCTGAGAAGGGGAGG + Exonic
1149416515 17:56465499-56465521 TTGTGAGCTCACATAAGAGGTGG - Intronic
1150817633 17:68406097-68406119 GTGGGAGCTAAGTTATGAGGAGG - Intronic
1151145762 17:72039358-72039380 GTGGGAGCTATTATAAGGAGAGG + Intergenic
1151304414 17:73253862-73253884 GTGGGAGCTCTCAGCAGGGGAGG - Intronic
1151606065 17:75136867-75136889 GTGGGACCTCTGGGAATAGGGGG - Intronic
1152364202 17:79845543-79845565 GTCTGGGCTCTGTTAAGAGGCGG - Intergenic
1153841863 18:9014976-9014998 GAGGGAACACAGATAAGAGGTGG - Intergenic
1155084736 18:22446857-22446879 CTGGGAGCACTGAGAAAAGGAGG + Intergenic
1155828808 18:30485182-30485204 GTGGGACCTCACAGAAGAGGTGG + Intergenic
1158398191 18:57096143-57096165 TTGGGAGCAGTGATAAGAGAAGG + Intergenic
1161204518 19:3034106-3034128 GTGGGAACCCTGATAGGAGCAGG - Intronic
1164728285 19:30481874-30481896 GTGGGAGCTAAGTTATGAGGAGG - Intronic
1165820387 19:38671117-38671139 GTGACAGCTCTGATAAAAGGTGG + Intronic
1166662682 19:44657527-44657549 GTGGAAGCCCTGAGGAGAGGTGG + Intronic
1166862249 19:45817199-45817221 GGGGGAGCTCTGGTAAAAGGCGG - Intronic
1168057554 19:53871625-53871647 GTCGGAGCTCTTATTAGATGTGG + Intronic
925551341 2:5078838-5078860 ATGGTGGCTCTGACAAGAGGAGG - Intergenic
928413709 2:31073881-31073903 GTGGCAGCTGTGCTAAGGGGAGG + Intronic
930368514 2:50474550-50474572 GTGAGAGCTCTGAAAAGAAATGG + Intronic
936268836 2:111032883-111032905 CTAGGAGCTCTGATGAGAGCTGG + Intronic
936509218 2:113131983-113132005 GTTTGAGCTCTGAGAAGATGGGG - Intronic
938037517 2:128047472-128047494 GTGGGAGCTAAGCTATGAGGAGG - Intergenic
940431759 2:153599870-153599892 GTGTCAGCTCTGAGAAGAGGGGG - Intergenic
945460295 2:210100122-210100144 GTGGGTGGTCTGACAGGAGGCGG - Intronic
948302536 2:236918725-236918747 GTGGGAGCTTTGAAAGGACGCGG - Intergenic
1169084327 20:2817208-2817230 CTGGGGGCTTTGAGAAGAGGGGG + Intronic
1169572101 20:6917579-6917601 GTGGGAGCTAAGCTATGAGGAGG + Intergenic
1169953094 20:11069929-11069951 GAGGGAGCTCTGAGAAGACGGGG - Intergenic
1171259305 20:23717811-23717833 ATGGAAGCTCAGATGAGAGGAGG + Intergenic
1174365132 20:50052050-50052072 GTGGGTGATCTGACAGGAGGCGG + Intergenic
1175112069 20:56655403-56655425 GTGGGAGGACTGGGAAGAGGAGG + Intergenic
1175403048 20:58711399-58711421 GGAGGAGCTCTGAGAGGAGGAGG + Intronic
1175841689 20:62031986-62032008 GGGGGAGCTCTGAGGAAAGGAGG - Intronic
1179230643 21:39500747-39500769 GTGGGAGCTTTTATGAGAGCTGG + Intronic
1179342984 21:40530416-40530438 TTGGGAGCTCTGATAACAGGTGG + Intronic
1181497106 22:23293540-23293562 GTGGCAGCTGTGATGAGAGGGGG + Intronic
1182117219 22:27763761-27763783 GTGGGAGCTCTGGAAGGTGGTGG - Intronic
1183894872 22:40960239-40960261 GTGGGAGCTTTGAGTTGAGGGGG + Intronic
1184530300 22:45051330-45051352 GTGGGCGCCCTGGTAAGAAGTGG - Intergenic
1184590317 22:45477608-45477630 GTGAGATCCCTGAGAAGAGGTGG - Intergenic
1184769525 22:46589300-46589322 GGGGCAGCTCTGATATGTGGGGG + Intronic
1184769537 22:46589336-46589358 GGGGCAGCTCTGATATGTGGGGG + Intronic
953970372 3:47342594-47342616 GTGGGAGAGGTGATAAGAGATGG + Intronic
955420384 3:58730566-58730588 GTGGGACATGAGATAAGAGGAGG + Intronic
958010876 3:87877897-87877919 GTGGGAGGTCTGGAAAGAGGTGG - Intergenic
959301470 3:104607728-104607750 GTGGGAGCAATAATGAGAGGGGG - Intergenic
959403997 3:105938434-105938456 GTGGGAGATCTCATAAGTAGAGG - Intergenic
959834824 3:110906058-110906080 GAGGGGGCTGAGATAAGAGGTGG - Intergenic
960524920 3:118698825-118698847 GTGGGAGCTAAGCTATGAGGAGG + Intergenic
961313405 3:126017903-126017925 GTGGGAGACCTGGTTAGAGGTGG - Intronic
961350020 3:126293967-126293989 GTGGGAGCTGGGAACAGAGGAGG - Intergenic
962537030 3:136339096-136339118 GTTGGGGCCCTGATAAGAAGAGG + Intronic
964621159 3:158721246-158721268 GTGGGGGATCTGATTAGAGATGG + Intronic
967023124 3:185540196-185540218 GTGGGACCTCTGAGAAGATGGGG - Intronic
967457003 3:189700102-189700124 GAGTGAGCTTTGATAAAAGGTGG + Intronic
969043207 4:4317273-4317295 GGGGGAGCGCTGAAGAGAGGAGG + Intronic
969425161 4:7120010-7120032 GTGGGAGCTCTGGGAACAGGAGG + Intergenic
974251042 4:59383087-59383109 GTGGGAGCTAAGCTATGAGGAGG - Intergenic
975486438 4:74938504-74938526 GTGGTAATTCTGAGAAGAGGTGG + Intronic
982550131 4:156787339-156787361 ATGATAGGTCTGATAAGAGGAGG + Intronic
984624863 4:181995884-181995906 CTGGGACCTGTGAAAAGAGGTGG - Intergenic
984843098 4:184086563-184086585 GGGTTTGCTCTGATAAGAGGTGG - Intergenic
985943909 5:3162258-3162280 GTGTGACATCTGAGAAGAGGTGG - Intergenic
986294796 5:6429106-6429128 GTGGCAGATCTGATAGGAGGTGG - Intergenic
986538815 5:8822021-8822043 GAGGGAGTTCTCATAAGAGCTGG + Intergenic
986581373 5:9269975-9269997 CTGGGAGCTCAGATATCAGGAGG + Intronic
989565768 5:42899346-42899368 GTGGGAGCTCTGCTGCGAGCTGG - Intergenic
992096765 5:73370028-73370050 GTGGGAGCTCTGCTAAGACAAGG + Intergenic
992243418 5:74793492-74793514 GTGGGAGCTAAGCTATGAGGAGG + Intronic
995121115 5:108536137-108536159 GTGGGACCTCAGAGAAGAGTTGG + Intergenic
995490177 5:112683001-112683023 GTTGGAGCCCTTATAAGAAGAGG - Intergenic
995860951 5:116639868-116639890 GTAGGAGCTCAGAGAAGAGTTGG - Intergenic
996590572 5:125142704-125142726 GTGGTAGCTGTGATAAGAAGAGG + Intergenic
1000998828 5:167985922-167985944 GTGGTAGCTTTGAGAAGCGGAGG - Intronic
1006708062 6:36039198-36039220 GGGGGAGCTCTGATGAAAAGAGG - Intronic
1007192537 6:40031796-40031818 ATGGGACCTTTAATAAGAGGTGG - Intergenic
1007451023 6:41940646-41940668 GTGGGAGCGCTGAAGTGAGGTGG + Intronic
1008697265 6:54054173-54054195 GTGAGAGCGCTGATAAGAAAAGG - Intronic
1009440688 6:63674638-63674660 GTAGGGGCTCTGTTAAGAGGAGG + Intronic
1015332454 6:131996799-131996821 GTGAGGGCTCTGATAAGAGGAGG - Intergenic
1017871939 6:158493950-158493972 GTGGGAGCTGTGATGGGAAGTGG - Intronic
1018359886 6:163056686-163056708 GTAGGTGCTCTTATACGAGGAGG + Intronic
1018608547 6:165624149-165624171 GTGGGAACTCTTGTGAGAGGTGG - Intronic
1019206265 6:170364633-170364655 GAGGGAGCTCTGCAAAGATGGGG - Intronic
1020521296 7:9190516-9190538 GTGGGAGCTAAGCTATGAGGAGG + Intergenic
1022394440 7:29973380-29973402 GTGAGACCTCTGCTTAGAGGAGG - Intronic
1022511136 7:30935528-30935550 GAGTCAGCTCTGATCAGAGGAGG - Intergenic
1023283529 7:38595237-38595259 GGGGGAGCTGTGATATGTGGAGG - Intronic
1025265927 7:57456962-57456984 GTGGCAGCTCTGAAAGGAGGAGG - Intronic
1030983233 7:116210661-116210683 GTGGGATCCCGGATAGGAGGAGG + Exonic
1032467818 7:132157620-132157642 GGGGGAGCTGTGATAGGAGCAGG - Intronic
1032572976 7:133020944-133020966 GGGGGAGAACGGATAAGAGGGGG + Intronic
1033290443 7:140078479-140078501 GTGGGAGCTCTGGGAGGAGCAGG + Intergenic
1034440464 7:151083315-151083337 GTGGGAGGGGTGATGAGAGGTGG - Intronic
1035094586 7:156343144-156343166 GTGGGAGCTCAGATGGCAGGTGG + Intergenic
1036229147 8:6984805-6984827 GTGGGAGCTCTGACAGGCTGAGG - Intergenic
1036231600 8:7003910-7003932 GTGGGAGCTCTGACAGGCTGAGG - Intronic
1037785763 8:21902191-21902213 GTGGCAGCTCAGATGAAAGGAGG + Intergenic
1037829367 8:22178875-22178897 GTAGAAGCACTGAGAAGAGGGGG - Intronic
1038271314 8:26078301-26078323 GTGGGGGCTGTGACAGGAGGTGG - Intergenic
1038271330 8:26078364-26078386 GTGGGGGCTGTGACAGGAGGTGG - Intergenic
1038433787 8:27520651-27520673 CTGGGAGTCCTGATCAGAGGAGG - Intronic
1039374166 8:37016492-37016514 GTGGGAGCTTGGAGAAGAGAGGG - Intergenic
1039850524 8:41360956-41360978 CTGGGAGCTCTGATTTGGGGTGG + Intergenic
1041726866 8:61026171-61026193 GTGAGTGTTCTTATAAGAGGAGG + Intergenic
1041728550 8:61042039-61042061 GTTGGAGCTTTGACCAGAGGAGG - Intergenic
1042130053 8:65579255-65579277 TTGGGTGCTCTGGTATGAGGTGG + Intergenic
1042740657 8:72041185-72041207 TTGGGAGCTCTAATGTGAGGTGG - Intronic
1044777055 8:95701007-95701029 GTGTGAGCTCAGATTTGAGGGGG - Intergenic
1046184751 8:110697988-110698010 GTAGGAGCTCCGAGAAGAGAGGG + Intergenic
1048140626 8:131790867-131790889 GTTGGTGCTCTTATAAGAAGAGG - Intergenic
1048885223 8:138904151-138904173 GTGTGAGCTCTGCAATGAGGTGG - Intronic
1055739601 9:79372219-79372241 GTGGCAGCTCTGTCAGGAGGAGG - Intergenic
1056460612 9:86806201-86806223 CAGGGAGCTCTGATGAGAGAAGG - Intergenic
1056792098 9:89632706-89632728 TTAGGATCTCTGATAAGAGCTGG - Intergenic
1057701243 9:97364613-97364635 GTGAGAGGGCTGATGAGAGGGGG - Intronic
1058968392 9:110057865-110057887 GAGGAAGCTCTGCTTAGAGGAGG + Intronic
1186283051 X:8014689-8014711 GTGCAAGCTTTGATATGAGGAGG - Intergenic
1187358967 X:18606597-18606619 GTGGGAGCTCCTAGAACAGGTGG + Intronic
1191576334 X:62710356-62710378 GTCATAGCTCTGATAAGTGGGGG + Intergenic
1192290755 X:69792169-69792191 GTGGGAGCTAAGCTATGAGGAGG - Intronic
1194695317 X:97041410-97041432 GTGGGAGCTATGTTAACTGGTGG + Intronic
1195069606 X:101266532-101266554 GTCAGAGCTCTGCTGAGAGGCGG - Intergenic
1195486878 X:105418836-105418858 TTTGGAGATCTGATAAAAGGAGG + Intronic
1195875416 X:109535655-109535677 ATTGGAGCTCAGATAAGGGGTGG + Intergenic
1196336482 X:114542289-114542311 GTGGGAGCTAAGCTATGAGGAGG - Intergenic
1197145021 X:123162206-123162228 GTGGGAGCTAAGCTATGAGGAGG - Intergenic
1199135350 X:144243749-144243771 GAGAGATCTCTGATAAAAGGGGG - Intergenic
1199579110 X:149343899-149343921 ATGGGAGTTCTGATAACTGGAGG - Intergenic
1200240222 X:154489451-154489473 GTGGGAGCTCTGACAAAAGGAGG - Intronic
1201947608 Y:19528570-19528592 TCGGGAGTTCTGATAAGAGAGGG + Intergenic