ID: 1064582183

View in Genome Browser
Species Human (GRCh38)
Location 10:16805844-16805866
Sequence GAGGCACGCTTCCGAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064582180_1064582183 -10 Left 1064582180 10:16805831-16805853 CCCATATCTGTAAGAGGCACGCT No data
Right 1064582183 10:16805844-16805866 GAGGCACGCTTCCGAGTGGAAGG No data
1064582178_1064582183 5 Left 1064582178 10:16805816-16805838 CCAATTCTATCATCACCCATATC 0: 1
1: 0
2: 3
3: 16
4: 187
Right 1064582183 10:16805844-16805866 GAGGCACGCTTCCGAGTGGAAGG No data
1064582177_1064582183 29 Left 1064582177 10:16805792-16805814 CCAAATCTGAGACTGTGAGATAT 0: 1
1: 0
2: 0
3: 14
4: 174
Right 1064582183 10:16805844-16805866 GAGGCACGCTTCCGAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064582183 Original CRISPR GAGGCACGCTTCCGAGTGGA AGG Intronic
No off target data available for this crispr