ID: 1064582716

View in Genome Browser
Species Human (GRCh38)
Location 10:16810472-16810494
Sequence AGAGCTGTGCATAGCCCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064582716_1064582722 1 Left 1064582716 10:16810472-16810494 CCCCCCGGGCTATGCACAGCTCT 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1064582722 10:16810496-16810518 AACTCGCCAGTGTGTGGCAACGG No data
1064582716_1064582724 28 Left 1064582716 10:16810472-16810494 CCCCCCGGGCTATGCACAGCTCT 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1064582724 10:16810523-16810545 TCCTCTTGACCCTAGCACACTGG No data
1064582716_1064582721 -5 Left 1064582716 10:16810472-16810494 CCCCCCGGGCTATGCACAGCTCT 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1064582721 10:16810490-16810512 GCTCTGAACTCGCCAGTGTGTGG No data
1064582716_1064582726 29 Left 1064582716 10:16810472-16810494 CCCCCCGGGCTATGCACAGCTCT 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1064582726 10:16810524-16810546 CCTCTTGACCCTAGCACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064582716 Original CRISPR AGAGCTGTGCATAGCCCGGG GGG (reversed) Intronic
900523846 1:3119033-3119055 AGAGCTGGGGGTGGCCCGGGAGG + Intronic
900627239 1:3614043-3614065 AAAGCTATGCATGGCCTGGGAGG - Intergenic
903290809 1:22313205-22313227 AGAGCTGTGCACAGCTCTTGAGG + Intergenic
903384355 1:22916833-22916855 AGAGCTGTGCAGCGCCAGGCTGG + Intergenic
903677040 1:25071020-25071042 AGAGCTGTGCAAAGGCCTGAAGG - Intergenic
904974385 1:34444715-34444737 AGAGCTGAGCAAAGCCCCTGAGG + Intergenic
905267784 1:36766661-36766683 AGGGCTGTGAATGGCCCGGATGG + Intergenic
907772214 1:57476794-57476816 AGAGCTGGGCTCAGCCTGGGGGG + Intronic
911120719 1:94293701-94293723 GAAGCTGTGCATAGCGGGGGAGG + Intergenic
916880188 1:169013184-169013206 AGAGCTGTGTGGAGCCTGGGAGG - Intergenic
922663108 1:227447389-227447411 AGAGACGGGCATGGCCCGGGAGG - Intergenic
923121734 1:230998483-230998505 AGAGCTGTGCATAGGCAGAGGGG - Intronic
923337587 1:232984015-232984037 AGCGCTGTGCCTGGCCAGGGAGG + Exonic
923558816 1:235022904-235022926 AGAGCTGTGGAGAGCCCATGGGG + Intergenic
923864674 1:237927105-237927127 TGAGCTGTGCGTGGCCCTGGAGG + Intergenic
1063963776 10:11328796-11328818 AGAGCTGTGCTGGGCCCGTGGGG + Intronic
1064146820 10:12832477-12832499 AGAGCCGTGCATGGTCCTGGGGG - Exonic
1064582716 10:16810472-16810494 AGAGCTGTGCATAGCCCGGGGGG - Intronic
1066760088 10:38741467-38741489 AGAGCTGAGCAGAGTCAGGGCGG - Intergenic
1067320753 10:45218616-45218638 AGAGCTGTGGATAGCCCAGGGGG - Intergenic
1069656876 10:70096545-70096567 GGAGCTGTTAATAGCCAGGGTGG + Intronic
1069709956 10:70481804-70481826 AGACCTGAGCATAGCCAGGTGGG - Intronic
1069840941 10:71339036-71339058 AGAGCAGGGCAGAGACCGGGTGG - Intronic
1072801246 10:98393769-98393791 AGAGCAGTGCCAAGCCGGGGAGG - Intronic
1077502562 11:2916027-2916049 AGAGCCTTGCAAAGCCCCGGAGG - Intronic
1080201608 11:29677972-29677994 AGATCTGTGCAGAGCAAGGGAGG - Intergenic
1081594096 11:44447253-44447275 ACAGCTGTGCAGAGCTCAGGCGG - Intergenic
1083622815 11:64057327-64057349 AGAGCTGTGCACATACAGGGTGG - Intronic
1083991210 11:66246842-66246864 AGAGCTGTCCACAGGCCAGGTGG - Intergenic
1084361350 11:68670263-68670285 GGAGCTGTGAAGTGCCCGGGGGG - Intergenic
1084673324 11:70620252-70620274 AGGCCTCTGCATAGCCCGGCTGG + Intronic
1088410397 11:109527628-109527650 AGAGCTGTGCAAAACCCATGTGG - Intergenic
1089138886 11:116270787-116270809 AGAGCTGGGCAGGGCCCGGGTGG + Intergenic
1089524469 11:119087923-119087945 AGTGCTGTGCACAGCCAGGTGGG - Intronic
1089559809 11:119338141-119338163 TGTGCTGGGCATAGCCTGGGTGG - Intergenic
1092022539 12:5214475-5214497 AGAGCTGTAAATAGCCCCGTGGG + Intergenic
1093263471 12:16970109-16970131 AGAGCTCTGCATGGCTGGGGAGG - Intergenic
1093994404 12:25625863-25625885 AGGGCTGTGTACAGCCCAGGTGG - Intronic
1095985350 12:47995612-47995634 AGAGCTGGGCAGAGCCTGGGAGG + Intronic
1097167703 12:57094405-57094427 AGAGCTACGCACAGCCAGGGAGG + Intronic
1113265040 13:108607556-108607578 AGAGTTGTGCATGGCTAGGGAGG - Intronic
1113669064 13:112163591-112163613 AGAGGTGGGCTTAGCGCGGGGGG - Intergenic
1114852853 14:26401443-26401465 AAAGCTGTGCAAAGCCTGGCTGG - Intergenic
1116391656 14:44398919-44398941 AGAGTTCTGCATGGCCGGGGAGG - Intergenic
1118809253 14:69261335-69261357 AGAGCTGTGCGTGGCCAGGCAGG + Intronic
1121571842 14:94952105-94952127 AGAGCTGAGCAAGGCCAGGGCGG + Intergenic
1124444063 15:29713259-29713281 AGACATGTGCACAGCCCTGGAGG + Intronic
1129324270 15:74791807-74791829 AGGACTCTGCATTGCCCGGGGGG - Intronic
1132585276 16:703461-703483 AGAGCTGGGCAGGGCCCTGGTGG + Intronic
1132747856 16:1444392-1444414 AGAGCTGGGCACAGGCCAGGGGG + Exonic
1141819475 16:86434999-86435021 AAAGCTCTGCATAGTCCAGGTGG - Intergenic
1143610153 17:8013406-8013428 AAAGCCGTGCATGGCCAGGGTGG + Intronic
1145293696 17:21571859-21571881 ACAGTTCTGCATAGCCGGGGAGG - Intronic
1145386288 17:22414122-22414144 ACAGTTCTGCATAGCCGGGGAGG + Intergenic
1152637848 17:81437497-81437519 AGGGCTGAGCATGGCCTGGGAGG - Intronic
1203165524 17_GL000205v2_random:89576-89598 AGAGCTGTGCATAACTCGCTGGG - Intergenic
1156877459 18:42032183-42032205 ATAGCAGTGCACAGCCCCGGAGG + Intronic
1157833624 18:50879229-50879251 GGAGCTGAGCATCGCCAGGGCGG + Exonic
1165374083 19:35429371-35429393 AGAGCTGTCCATAACCCATGTGG - Intergenic
1166029015 19:40111846-40111868 ACAGTTCTGCATAGCCAGGGAGG + Intergenic
1167019274 19:46861586-46861608 GGAGCACTGCAGAGCCCGGGAGG - Intergenic
1168552601 19:57310094-57310116 ACAGTTCTGCATAGCTCGGGAGG - Intergenic
925615084 2:5737569-5737591 AGAGATTTGATTAGCCCGGGAGG + Intergenic
928052013 2:28008887-28008909 AGAGCTGCCCATATCCAGGGGGG - Intronic
942182208 2:173390662-173390684 AGAGCAGTGCCCAGCCCGGGAGG - Intergenic
943085551 2:183306787-183306809 AGAGTTGTGCTTAGACCTGGGGG + Intergenic
944160273 2:196652503-196652525 AGAGCTGTTCAAAGCCTTGGGGG - Intronic
944195837 2:197052006-197052028 AGAGCTCTGCACTGCCCGGATGG - Intronic
946193691 2:218021165-218021187 AGAGCTCTGCACAGCCCTTGGGG + Intergenic
946909377 2:224444447-224444469 AGACCTGTGCCTAGACCTGGGGG + Intergenic
1170095613 20:12642761-12642783 AGAGCTTTGCAGAGCCAGGCAGG + Intergenic
1170213200 20:13865981-13866003 AGAGGTGTGCAGAGCCCTAGGGG + Intronic
1174260509 20:49291379-49291401 AGGGCTGTGCAAAGCTCTGGGGG - Intergenic
1174344055 20:49916446-49916468 AGACATGTGCAGAGCTCGGGGGG - Intergenic
1176406228 21:6369503-6369525 AGAGCTGTGCATAACTCGCTGGG + Intergenic
1178595785 21:33951236-33951258 AGTGCTGTGCATGGCCCCAGAGG - Intergenic
1179576041 21:42309087-42309109 ACAGCTGTCCAGAGCCCAGGTGG - Intergenic
1180971412 22:19818038-19818060 ACAGCTGAGCACAGGCCGGGTGG + Intronic
1181651732 22:24262675-24262697 TGAGCTGCTCAAAGCCCGGGAGG - Intergenic
1183620067 22:38967025-38967047 GGAGCTGTGCTTGGTCCGGGTGG + Intronic
1184608552 22:45588112-45588134 AGGGCTGTGCAGAGCAGGGGAGG + Intronic
1184720291 22:46308738-46308760 AGAGCTGGGCAGGGCCGGGGAGG - Exonic
1185134873 22:49063765-49063787 AGGGGTGTGCAGAGCCCGTGGGG + Intergenic
1185347579 22:50317149-50317171 AGAGCTGGACACAGCCCAGGTGG + Intronic
949845062 3:8361536-8361558 AGAGTTCTGCATAGCTGGGGAGG + Intergenic
951442051 3:22734619-22734641 ACAGCTATGCATGGCCGGGGAGG - Intergenic
953210465 3:40870653-40870675 AGTGCTGTCCAAAGCCAGGGAGG - Intergenic
953888779 3:46735215-46735237 AGAGCTTTGGAAAGCCCAGGAGG + Intronic
956030312 3:65030198-65030220 AGAGCTGTGCAAAGGCCCTGTGG + Intergenic
959945941 3:112125436-112125458 AGAGCTGTGCTCAGCCTGAGAGG + Intronic
962920057 3:139942551-139942573 AGAGGTGTGCATGGCAAGGGCGG + Intronic
966878998 3:184339066-184339088 AGAGCTGGGCAATGCCGGGGAGG + Intronic
968438446 4:608510-608532 AAAGCTGTGCATGACTCGGGAGG - Intergenic
968759086 4:2432896-2432918 AGAGATGGGCCTAGGCCGGGTGG - Intronic
969347210 4:6576847-6576869 AAGGCTGTGAATAGCCCGGTGGG - Intronic
969615935 4:8252580-8252602 AGGGCTGTGCGTGGCCAGGGTGG + Intergenic
974525167 4:63042223-63042245 ATAGTTCTGCATAGCCAGGGAGG + Intergenic
982098556 4:151946168-151946190 ACAGCTCTGCATGGCCGGGGAGG - Intergenic
987188653 5:15450963-15450985 GGAGCTGTGCATGGCCCTGGAGG + Intergenic
988435478 5:31169568-31169590 AGTGCTGTGCAAAACCCAGGAGG + Intergenic
990519674 5:56566815-56566837 AGAGCTGTGCATGGCAAGGAGGG - Intronic
995696880 5:114888930-114888952 ACAGTTCTGCATTGCCCGGGAGG + Intergenic
996234422 5:121108607-121108629 AGAGCTGAGCAGAGGCCCGGCGG - Intergenic
997376962 5:133404166-133404188 AGGGCTGAGGATACCCCGGGCGG + Intronic
999276341 5:150333053-150333075 AGAGCTCAGCATACCCCGGGAGG + Intronic
1001191657 5:169637557-169637579 AGGGCTGTGCTTAGCCTGCGGGG - Intronic
1007272928 6:40651876-40651898 AGAGCTGTGCACAGCAGGGTGGG - Intergenic
1007985705 6:46205251-46205273 CGAGCTGTGCGTGGCCCTGGAGG + Intergenic
1009915391 6:69988962-69988984 AGACCTGTGCAAAGCCCAGAAGG - Intronic
1012849588 6:104430794-104430816 AGATCTGTGCTTGGCCAGGGTGG + Intergenic
1013797644 6:113904892-113904914 AAAGCTGTGAAAAGCCTGGGAGG - Intergenic
1017023696 6:150162955-150162977 AGCGGTGTGCAAAGCCCTGGGGG + Intronic
1018729816 6:166640414-166640436 GGAGCTGAGAATAGCCCGTGTGG + Intronic
1019204397 6:170347288-170347310 ACAGCTGTGGATAGCAAGGGAGG + Intronic
1022410632 7:30136085-30136107 AGAGGTGTGTGTGGCCCGGGCGG + Intronic
1024978293 7:55133733-55133755 AGGGCAGTGCAGAGCCAGGGCGG - Intronic
1025074378 7:55930148-55930170 AGAACTGTTCATAACCTGGGAGG - Intronic
1030296359 7:107932435-107932457 ACAGCTGTGCAGGGCCTGGGTGG + Intronic
1036124318 8:6049066-6049088 CCAGCTGTGCCGAGCCCGGGTGG + Intergenic
1036721609 8:11180655-11180677 AGGGCTTTGCAAAGCCCAGGTGG + Intronic
1037045078 8:14289865-14289887 ACAGTTGTGCATAGCTGGGGAGG + Intronic
1037780286 8:21863589-21863611 GTAGCTGTGCATAGCCCTAGTGG - Intergenic
1040039152 8:42897940-42897962 AGGGATGCGCAGAGCCCGGGCGG + Intronic
1041847124 8:62342349-62342371 AGAGCTGTGCAGAGTCCTGATGG + Intronic
1048273316 8:133046533-133046555 AGAGCTTTGCATACCCAAGGTGG + Intronic
1048416737 8:134235238-134235260 AGAGCTGCCCAAAGCCCTGGGGG - Intergenic
1048833381 8:138497087-138497109 AGAGGTGAGCGCAGCCCGGGAGG - Intergenic
1049189134 8:141276942-141276964 AGGGCAGTGCTTAGGCCGGGGGG - Intronic
1049255156 8:141609766-141609788 AAAGCTGTGCAGAGCCTGGCTGG - Intergenic
1052542259 9:29826575-29826597 AGAGCTTAGCATCGCCAGGGCGG - Intergenic
1053830478 9:42074755-42074777 AGAGATGTGCAGAGCCAGGAAGG + Intronic
1054600081 9:67112700-67112722 AGAGATGTGCAGAGCCAGGAAGG - Intergenic
1056732338 9:89177594-89177616 AGAGCTGGGCAGCCCCCGGGAGG - Intronic
1058061365 9:100500089-100500111 AGAGCTCTGCATAGCATGGAAGG + Intronic
1060400551 9:123346347-123346369 AGCGCACTGCACAGCCCGGGAGG - Intergenic
1060551791 9:124489111-124489133 AGCCCTGTGCATAGCTCTGGCGG - Intronic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060758556 9:126229788-126229810 AGAGCTGTGCAAAGGCCCTGAGG + Intergenic
1062006917 9:134243203-134243225 AGAGCTGTGTAAAGCCCAGCAGG + Intergenic
1198392029 X:136185866-136185888 AGAGCTGTGCACTTCCCTGGTGG + Intronic