ID: 1064583380

View in Genome Browser
Species Human (GRCh38)
Location 10:16816272-16816294
Sequence TGATAGGTGTCCCACTTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 57}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064583380_1064583388 16 Left 1064583380 10:16816272-16816294 CCCTTCAAGTGGGACACCTATCA 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1064583388 10:16816311-16816333 CCCTGACCGCCCTCACTTGGAGG No data
1064583380_1064583385 13 Left 1064583380 10:16816272-16816294 CCCTTCAAGTGGGACACCTATCA 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1064583385 10:16816308-16816330 CGCCCCTGACCGCCCTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064583380 Original CRISPR TGATAGGTGTCCCACTTGAA GGG (reversed) Intronic
909288950 1:73857960-73857982 TGATAGATGTTACCCTTGAAGGG + Intergenic
910143108 1:84048869-84048891 TGATAGCTGTGGCATTTGAAAGG + Intergenic
916625781 1:166553555-166553577 GGATAGTTGCCCCACCTGAAAGG + Intergenic
918616955 1:186555714-186555736 TGATAAGAGTCCAAATTGAATGG + Intergenic
920738938 1:208561680-208561702 TGATAGGTTTCCCTCTAAAATGG + Intergenic
923241201 1:232087336-232087358 TCCTATGTGTCCCACTTCAAGGG + Intergenic
1064583380 10:16816272-16816294 TGATAGGTGTCCCACTTGAAGGG - Intronic
1074028579 10:109662730-109662752 TGAGAAGGATCCCACTTGAATGG + Intergenic
1075980690 10:126736488-126736510 TGTTAGGTTTCCCAGTAGAAAGG - Intergenic
1078523260 11:12080521-12080543 TGTTAGAGGTCCCACCTGAATGG - Intergenic
1082247723 11:49943608-49943630 TGAAATGTGTCTCACTTGGAGGG + Intergenic
1087317887 11:96625615-96625637 TTGTGGGTGTTCCACTTGAATGG + Intergenic
1089962472 11:122628034-122628056 TGATGGGTGTGCAACTTTAAAGG - Intergenic
1092214191 12:6669137-6669159 TGACAGTTGTGGCACTTGAAGGG + Exonic
1096675426 12:53223311-53223333 AGGTAGGAGTCCCACCTGAAGGG + Intronic
1097581872 12:61467545-61467567 TGAGATGTCTCCCAGTTGAAGGG + Intergenic
1114433062 14:22678935-22678957 TGATGGGTGTCAAACTTGCAGGG + Intergenic
1116774876 14:49167645-49167667 TCAAAGTTGTCCCACCTGAAAGG - Intergenic
1122680513 14:103457965-103457987 TGGCAGGTCTCCTACTTGAAAGG - Intronic
1131905585 15:97138482-97138504 TGATGGGTGTCCTTATTGAAAGG + Intergenic
1134799042 16:17067631-17067653 TCATAGGGGTCCCTCATGAATGG + Intergenic
1141788958 16:86220018-86220040 TGATAGCTGTCCCCCTTGGGAGG - Intergenic
1143941747 17:10549593-10549615 TGACCAGTGTCCCTCTTGAAAGG + Intronic
1149013841 17:51885700-51885722 TGAAAGATCTCCCAGTTGAATGG - Intronic
1158208543 18:55021406-55021428 TTCTAGGTAACCCACTTGAAAGG - Intergenic
1162379814 19:10324808-10324830 TGTTAGGTGACCCAGCTGAATGG - Intronic
925423051 2:3727036-3727058 TGATATGTTTGCCACTTGGAAGG - Exonic
928004827 2:27554905-27554927 TGAGGGGTTTCCCTCTTGAATGG - Intronic
937029792 2:118729207-118729229 GGATTGTTGTCCCACTGGAATGG + Intergenic
937812996 2:126219282-126219304 TGAAAAGTGTCACACTGGAAAGG + Intergenic
1169076353 20:2762138-2762160 TGAAAGGTGTTCCATTTGCAAGG - Intergenic
1170941599 20:20852943-20852965 TGATGGGTTTCAGACTTGAATGG - Intergenic
950948225 3:16972952-16972974 GGATAAGTGTCCCAATTAAAAGG - Intronic
955688606 3:61568449-61568471 TTATAGTTGTCCCAATAGAAGGG - Intronic
962102253 3:132355197-132355219 TGATATGTGTCCCCTTTAAAAGG - Intronic
962599420 3:136979733-136979755 GGCTTGGTGTCCCACTTGAATGG + Intronic
966512490 3:180779705-180779727 AGATAAATGTCCCACTTAAAAGG - Intronic
974449194 4:62029402-62029424 TGACAGGTGTCAAATTTGAAAGG - Intronic
976464996 4:85357113-85357135 TGATAGGTTTCCCTCTTTATAGG + Intergenic
979972669 4:127156936-127156958 TGAGAAGTTTCACACTTGAATGG - Intergenic
981876204 4:149549155-149549177 TGATAGGTGGCCCAACTGAGTGG - Intergenic
986547040 5:8908680-8908702 TGACAGGTGGCCCACTGGAGTGG + Intergenic
996428703 5:123345116-123345138 TGATTTTTGTGCCACTTGAATGG - Exonic
1001673983 5:173497471-173497493 TGTTAGGTGTCACACTTGGTTGG - Intergenic
1013270168 6:108537764-108537786 TGATGGGTGTCCCTCTTTGATGG + Intergenic
1024573026 7:50740231-50740253 AGAATGGTGTGCCACTTGAATGG - Intronic
1027346945 7:77270601-77270623 TAATAGGTGTTTCTCTTGAAAGG - Intronic
1032457927 7:132087675-132087697 TGATAGCTGTGGCACTTGGAGGG - Intergenic
1035864650 8:3069476-3069498 TGCTGGGTGTCAAACTTGAATGG - Intronic
1040665469 8:49626294-49626316 TAAAAGTTGTCCCACTTCAATGG + Intergenic
1047197464 8:122734583-122734605 TAACAGGTGTCAGACTTGAAAGG - Intergenic
1050023815 9:1312233-1312255 TGGTAGGTGCCCCACATGAGTGG + Intergenic
1056202756 9:84292244-84292266 TGGTAGCTCTTCCACTTGAATGG - Intronic
1058284506 9:103159501-103159523 TTCTAAGTGTCCCACTTAAAAGG - Intergenic
1061987857 9:134140524-134140546 TCAGATGTGTTCCACTTGAAAGG + Intronic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1188252460 X:27914463-27914485 TCATAGTTATCCCACTTGAGAGG + Intergenic
1192972419 X:76247487-76247509 TGAAAGGTATCCAAATTGAAAGG - Intergenic
1196797523 X:119514259-119514281 TGAGAGGGGTGCCAATTGAAGGG + Intergenic