ID: 1064584741

View in Genome Browser
Species Human (GRCh38)
Location 10:16828821-16828843
Sequence AACGCCAGCTCTCCATCCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064584741_1064584746 8 Left 1064584741 10:16828821-16828843 CCAGAGGATGGAGAGCTGGCGTT 0: 1
1: 0
2: 2
3: 11
4: 125
Right 1064584746 10:16828852-16828874 CATAGAGTGTGAGATAGTTCTGG 0: 1
1: 1
2: 0
3: 11
4: 121
1064584741_1064584747 22 Left 1064584741 10:16828821-16828843 CCAGAGGATGGAGAGCTGGCGTT 0: 1
1: 0
2: 2
3: 11
4: 125
Right 1064584747 10:16828866-16828888 TAGTTCTGGACACAGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064584741 Original CRISPR AACGCCAGCTCTCCATCCTC TGG (reversed) Exonic
900507070 1:3035029-3035051 AACTCCAGGGCTTCATCCTCAGG + Intergenic
902245834 1:15119871-15119893 ACCCCCAGCACTCCAGCCTCAGG - Intergenic
903136553 1:21313229-21313251 AACGCCAGCTCAGCAGCATCTGG - Intronic
903919393 1:26788439-26788461 AACGGCAGCTCTGGACCCTCTGG - Exonic
905335474 1:37241668-37241690 AACGTGAAATCTCCATCCTCGGG + Intergenic
905490532 1:38340045-38340067 AACCCCAGCTCTCCCTGCTCTGG - Intergenic
906686836 1:47768280-47768302 AACGCCATCCCTGCATCCTCTGG - Intronic
908892047 1:68859603-68859625 AATGCCAGCTCTCAATACACTGG + Intergenic
915614705 1:157028225-157028247 CAAGCCAGCTCCCCATCCCCTGG - Intronic
917174909 1:172223228-172223250 AACCCCACCTCTCCAGTCTCTGG + Intronic
917856907 1:179108532-179108554 CCCGGCTGCTCTCCATCCTCTGG + Exonic
920249413 1:204613379-204613401 AATGCAAGGTCTCCAGCCTCTGG + Intergenic
921253348 1:213317811-213317833 GACCCCAGCTCTCAATCCCCCGG - Intergenic
922890533 1:229058462-229058484 ACCGCCAGCACTTGATCCTCTGG + Intergenic
924795684 1:247290629-247290651 GACGGCCTCTCTCCATCCTCAGG - Intergenic
1064584741 10:16828821-16828843 AACGCCAGCTCTCCATCCTCTGG - Exonic
1067084070 10:43229037-43229059 AATGCCAGTGCTCCATGCTCAGG + Intronic
1067322563 10:45235870-45235892 AACGTCAGCTCTCCATCCTATGG - Intergenic
1074112310 10:110431197-110431219 TGCCCCAGCTCTCCTTCCTCAGG - Intergenic
1074311175 10:112324589-112324611 AAAGCCACCTCTTCATCCTTTGG + Intergenic
1078396510 11:10986434-10986456 AATGCCAAGTCTCCATCCTTGGG + Intergenic
1083616486 11:64028972-64028994 AACCCCAGCTCTGCAGCCCCAGG + Intronic
1086151779 11:83619585-83619607 ACTGCCAGCTCCTCATCCTCAGG + Intronic
1089705218 11:120272764-120272786 AAGGCCAACCCTCCATCCCCAGG + Intronic
1090363450 11:126188525-126188547 AACCACAGCACTCCTTCCTCTGG + Intergenic
1090863387 11:130673836-130673858 AAGGCCTGCTCTCCTTCCTCTGG + Intronic
1092071377 12:5634159-5634181 ATCGGCAGCTTACCATCCTCAGG - Intronic
1094522548 12:31208242-31208264 AATGCCAGTCCTCCATTCTCAGG - Intergenic
1097161586 12:57049977-57049999 TAAGCCACCTCTCCATCCTGGGG - Exonic
1102208100 12:111104532-111104554 AATTCCAGCTCTTCACCCTCTGG + Intronic
1102217146 12:111169565-111169587 AGAGCCAGCCCTCCATCCTCAGG - Intronic
1102247966 12:111367197-111367219 AAGGCCAGCTCCCCATCCTTTGG + Intronic
1102755627 12:115337722-115337744 CACCCCAGTTCTCCATCATCAGG - Intergenic
1105452441 13:20512145-20512167 AACCCCAGCCCTCCAGCCCCGGG + Intronic
1114331325 14:21639844-21639866 AAGACCATCTCTCCATCCGCTGG - Intergenic
1116013781 14:39382107-39382129 ACTGCCTGCTCTCCATCGTCAGG + Intronic
1116586986 14:46718321-46718343 AACGTCATCTCTCCAACCCCTGG + Intergenic
1120015647 14:79470395-79470417 AAGGCGAGCACTGCATCCTCAGG + Intronic
1122313562 14:100812561-100812583 AGAGCCAGCTCTCCATCCAGTGG - Intergenic
1122470271 14:101961553-101961575 ACCGCCAGCGCCCCTTCCTCGGG + Intergenic
1122724143 14:103739543-103739565 AGCGACAGCTCCCCTTCCTCAGG + Intronic
1125060922 15:35422719-35422741 AAATCCTCCTCTCCATCCTCTGG + Intronic
1125912826 15:43456996-43457018 AACTCAAGCTCTCCATCTTTGGG + Exonic
1126560361 15:50036328-50036350 AACAGCAGCTCTCCTGCCTCAGG - Intronic
1128473954 15:67981250-67981272 AAAGCCAGCTGTCTTTCCTCTGG + Intergenic
1132371186 15:101300473-101300495 AAAACCAGCTCTCCAGCCTAAGG - Intronic
1135167827 16:20156344-20156366 ACCACCAGTTCTCCATCCCCAGG + Intergenic
1137648033 16:50093025-50093047 AAAGGCAGCTCTCTATCCTAGGG + Intronic
1137792301 16:51185352-51185374 AACCCCAGCTCTCCACCCCGTGG - Intergenic
1140181713 16:72726711-72726733 GCTGCCAGCTCTCCATCTTCAGG + Intergenic
1141198917 16:81882502-81882524 AACACCAGCTCTCCCTCTACGGG + Intronic
1141565206 16:84896991-84897013 AAGGCAAGCTCTTCCTCCTCAGG + Intronic
1142150429 16:88510253-88510275 AACCCCAGCTCTCCCTCCCCAGG + Intronic
1146356951 17:32142515-32142537 AGCGCCAGCTCCGCCTCCTCCGG - Exonic
1149033559 17:52110168-52110190 AATGCTAGCTCTCCCTCCCCTGG + Intronic
1149935844 17:60805898-60805920 AACGCCAGCACTCCATCCTGAGG - Intronic
1152230889 17:79113522-79113544 AAGGCCGTCTGTCCATCCTCTGG + Intronic
1153609628 18:6870619-6870641 AATGACAGCTCTTCAGCCTCTGG - Exonic
1155170451 18:23263252-23263274 AAGGCCATCTCTCCAGCATCTGG - Intronic
1157569637 18:48703961-48703983 GACGCCAGCTCTCCCACTTCTGG + Intronic
1160521217 18:79509299-79509321 GACGCCAGCTCTCCACCAGCCGG + Intronic
1161281620 19:3448782-3448804 ATACCCAGCTCTCCATCCCCCGG + Intronic
1164522695 19:28991019-28991041 AACGGCAGCTCCCCAGCATCAGG + Intergenic
1168298167 19:55388039-55388061 AACCCCAGCTCACCATGCGCAGG - Exonic
925416729 2:3675403-3675425 AAAGCAAGCTCTCCATTCACTGG + Intronic
925451605 2:3973858-3973880 AAGCCCAGCTCTCCCTCCACGGG + Intergenic
927179971 2:20438456-20438478 AAGGGCAACTCTCCTTCCTCAGG - Intergenic
927894761 2:26774593-26774615 AAAGTCAGCTCTCTATCCACTGG + Intronic
927911065 2:26900001-26900023 ATATCCAGCTCACCATCCTCAGG + Intronic
928848314 2:35708150-35708172 AAAGCCAACTGTCCATCCACTGG - Intergenic
930002774 2:46872211-46872233 TACTCCAGCCCTCCCTCCTCTGG + Intergenic
946152949 2:217788664-217788686 AACAGCTGCTCCCCATCCTCCGG - Intergenic
948405864 2:237718421-237718443 CAGGCTAGCTCTCCATCCACAGG - Intronic
1168840384 20:906306-906328 AGCGCCAGCTCACCAGCCACAGG + Intronic
1175501008 20:59450764-59450786 AATCCCTTCTCTCCATCCTCTGG + Intergenic
1178943787 21:36929302-36929324 AGCCCCAGCCCTCCATCCCCAGG + Intronic
1179884436 21:44307520-44307542 AACCCCAGCTCTGCAGCCCCAGG + Intronic
1183183970 22:36281187-36281209 AATGCCGGCTCTGCATCGTCGGG - Intergenic
1183786904 22:40034583-40034605 AAAGCCCGCTCTCCAGGCTCAGG - Exonic
1185274152 22:49943191-49943213 AAGGCCAGCCCTCCTTCCCCCGG - Intergenic
956750774 3:72342230-72342252 CAAGCCAGCTCTCCCTCCTCAGG + Intergenic
961627042 3:128271291-128271313 AAAGCCAGCTCTGCAGCCTCGGG - Intronic
962043703 3:131733822-131733844 AACCAAGGCTCTCCATCCTCGGG - Intronic
965348005 3:167576107-167576129 AACACCAGCTGTCCATCCAGAGG - Exonic
967188935 3:186968532-186968554 ATCTCCTGCCCTCCATCCTCAGG + Intronic
967225708 3:187289085-187289107 AACACCTGCTATCTATCCTCCGG + Intronic
968292530 3:197549634-197549656 AACCCCAGCTTGCCCTCCTCGGG - Intronic
969216917 4:5730496-5730518 AAGGGCATTTCTCCATCCTCTGG + Intronic
969472748 4:7399273-7399295 ACCGCCAGCCTTCCATCCACAGG - Intronic
973561522 4:52141556-52141578 AGCTCCCACTCTCCATCCTCTGG - Intergenic
974744919 4:66059732-66059754 AAAGCCAGCTCTCTAACCTTTGG + Intergenic
987147537 5:15006836-15006858 AACTACAGCTCCCCATCCTCTGG - Intergenic
993699713 5:91103986-91104008 AACGCCGGCTTTCCATGCTTGGG + Intronic
995347239 5:111135011-111135033 GACTCCACCTCTCCATTCTCTGG + Intergenic
998142420 5:139707673-139707695 GACCCTAACTCTCCATCCTCTGG - Intergenic
998458215 5:142290195-142290217 AATCCCAGCTCTGCATCCACTGG - Intergenic
998866934 5:146515002-146515024 AAACCCAGCTCTCCCTCCTCTGG - Exonic
999113531 5:149141964-149141986 AGTGCCAGCTCTGTATCCTCAGG - Exonic
999672454 5:153969520-153969542 AGAGCCAGATATCCATCCTCAGG + Intergenic
1000248045 5:159466028-159466050 AACCCCACCTCTCCATGCCCAGG - Intergenic
1001333670 5:170780663-170780685 AAAGCCCCCACTCCATCCTCAGG + Intronic
1001693864 5:173654659-173654681 AACTGCAGCTCTCCTGCCTCCGG + Intergenic
1006358655 6:33575402-33575424 GACGGCAGCTCGCCATCATCGGG - Exonic
1006923306 6:37640254-37640276 GACTCCAGCTTTCCAGCCTCTGG - Intronic
1008521073 6:52362571-52362593 CCCGCCAGCTCTCCAGGCTCAGG - Intronic
1011575189 6:88789799-88789821 AAAGCCTGTTATCCATCCTCTGG - Intronic
1019080622 6:169427108-169427130 AACACCTGCTTTCCAGCCTCAGG - Intergenic
1019770143 7:2878497-2878519 AAGGCCAGATCACCATCTTCTGG - Intergenic
1019912183 7:4107179-4107201 GACTCCAGGTCTCCTTCCTCTGG - Intronic
1020086228 7:5312374-5312396 GACGCCAGCCCTCCACCCTGGGG + Intronic
1021621972 7:22557630-22557652 AACTCCAGCTCTGCATACTATGG + Intronic
1025208077 7:57004698-57004720 GACGCCAGCCCTCCACCCTGGGG - Intergenic
1025663875 7:63572177-63572199 GACGCCAGCCCTCCACCCTGGGG + Intergenic
1031620001 7:123924379-123924401 AACCCCACCTCTCCATGCCCAGG - Intergenic
1034096844 7:148416855-148416877 AACTACACTTCTCCATCCTCTGG - Exonic
1035486582 7:159231059-159231081 AACGCCCCCGCTCCGTCCTCCGG - Intergenic
1035668244 8:1395306-1395328 AGCGCCACCTCCTCATCCTCCGG + Intergenic
1035669658 8:1407776-1407798 AGCGCCACCTCCTCATCCTCCGG + Intergenic
1035669666 8:1407822-1407844 AGCGCCACCTCCTCATCCTCCGG + Intergenic
1037281555 8:17247235-17247257 AAAGCCAGCTCATCCTCCTCGGG - Exonic
1038600194 8:28932862-28932884 AATACCAGATCTCCATCATCAGG - Intronic
1040890699 8:52313690-52313712 GACCCAAGCTCTCCATCCTAAGG - Intronic
1041795433 8:61742662-61742684 AGTGCCAGCTGTCAATCCTCTGG - Intergenic
1042186447 8:66140862-66140884 AACAACAGCTCTCCACCCCCTGG - Intronic
1046475197 8:114732807-114732829 AACCCCAGGTCTCCAAGCTCTGG - Intergenic
1048950139 8:139489823-139489845 AAGGACAGCTCACCATCCTCAGG + Intergenic
1049747683 8:144269931-144269953 CACGCCAGCCCTCCCTCCACTGG + Intronic
1057916777 9:99062495-99062517 AACAGCAGGTCTCCAGCCTCTGG - Intronic
1059072856 9:111157301-111157323 AAAGTCAGCACTCCATACTCAGG + Intergenic
1061012620 9:127964393-127964415 AACCCCAGGTCTCCATCACCAGG + Intronic
1061130082 9:128703570-128703592 GACACCACCTCTCCCTCCTCAGG - Intronic
1061925813 9:133805596-133805618 AATGCCACCTCCCCAGCCTCCGG + Intronic
1186323553 X:8455017-8455039 AACTCAAGCTCTCCATCATTAGG + Intergenic
1193076310 X:77359688-77359710 AATGCAAGCTCTCCTTCCTTTGG - Intergenic
1196866779 X:120077784-120077806 AACGCGTGCTCTCCCTCATCCGG - Intergenic
1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG + Intergenic
1197817614 X:130514319-130514341 AGGGCCAGTTCTCCATCCCCTGG - Intergenic
1199445410 X:147914602-147914624 AAGGACAGCTCTCTATCTTCTGG + Intronic
1202097962 Y:21273249-21273271 AAAACCAACCCTCCATCCTCTGG - Intergenic