ID: 1064586156

View in Genome Browser
Species Human (GRCh38)
Location 10:16841570-16841592
Sequence TAGATTAGAAAGGTCAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064586156_1064586161 28 Left 1064586156 10:16841570-16841592 CCACCCCTGACCTTTCTAATCTA 0: 1
1: 0
2: 3
3: 12
4: 257
Right 1064586161 10:16841621-16841643 TCCGCTTCTTGAGCCAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064586156 Original CRISPR TAGATTAGAAAGGTCAGGGG TGG (reversed) Intronic
902991805 1:20193010-20193032 TTGATTGGAAAGGTCAGCTGGGG + Exonic
903385024 1:22920529-22920551 AAGATTAGAAAGGTCAAGGGGGG - Intergenic
903454312 1:23476543-23476565 TAGATTGGAAGGGCCAGGAGAGG - Intronic
904026373 1:27506104-27506126 TAAATTAAATAGGTCAGGGGTGG + Intergenic
906537469 1:46559542-46559564 TAGATGAGAGAGGTGAGGAGTGG - Intronic
907918724 1:58894003-58894025 GAGATTTGTAAAGTCAGGGGTGG + Intergenic
908295445 1:62708200-62708222 TGGATTAGAAATGACAGGTGAGG + Intergenic
909218862 1:72928273-72928295 TTGAGTATAAAGGTCAGGGATGG - Intergenic
910465368 1:87493439-87493461 TAGACTAGAAAAGTCAAGGATGG + Intergenic
910678045 1:89834696-89834718 TTGACTGGAAAGATCAGGGGAGG + Intronic
911412174 1:97523574-97523596 GAGATTAGAAAGGGCGGGGAGGG - Intronic
912131879 1:106613588-106613610 TAAATGAGAAGGGGCAGGGGAGG - Intergenic
912381146 1:109248961-109248983 TAAATTAGAAGGGTCAGAGTGGG - Intergenic
912496573 1:110095539-110095561 TAGATTAGAATGGGGAGGGGAGG - Intergenic
914393047 1:147239190-147239212 TGGTTTAGAAAGGGGAGGGGGGG - Intronic
917265411 1:173215978-173216000 TTGATTTGATAGGTCTGGGGTGG - Intergenic
920493130 1:206434196-206434218 TAGATGAGAAAGCTCAGTGGTGG + Intronic
922101682 1:222482312-222482334 TTAAATAGAATGGTCAGGGGTGG - Intergenic
922262762 1:223957428-223957450 TTAAGTAGAATGGTCAGGGGTGG - Intergenic
922970936 1:229737573-229737595 TTGCTTAGAAAGGTCAGGACAGG - Intergenic
924344600 1:243062429-243062451 TTAAGTAGAATGGTCAGGGGTGG - Intergenic
1064586156 10:16841570-16841592 TAGATTAGAAAGGTCAGGGGTGG - Intronic
1064905429 10:20340613-20340635 TATAATATAAAGGCCAGGGGTGG + Intergenic
1066003230 10:31124144-31124166 TAGATTAAAAAGATAAGGGCAGG + Intergenic
1066406688 10:35126108-35126130 TAGATTAGAAAGGTCGGCCGGGG - Intergenic
1066731731 10:38442646-38442668 TTAAATAGAATGGTCAGGGGTGG + Intergenic
1066774549 10:38874674-38874696 TAGAATGGAATGGTCAGGAGGGG + Intergenic
1066975341 10:42363284-42363306 AAGATTAGAAAGGAGATGGGAGG - Intergenic
1067323862 10:45247889-45247911 GAGATCAGAAAGGTCAGGGGTGG - Intergenic
1067494428 10:46749138-46749160 TAAATGAGAGATGTCAGGGGAGG + Intergenic
1067600230 10:47591259-47591281 TAAATGAGAGATGTCAGGGGAGG - Intergenic
1069123663 10:64602266-64602288 CAGGTTAGAAAGGTGAGGGAGGG + Intergenic
1069426170 10:68290419-68290441 TTGATTTAAAAGTTCAGGGGTGG + Intronic
1070729905 10:78819508-78819530 TCGAGTAGAAAGGCCAGGGCTGG + Intergenic
1070804337 10:79262003-79262025 TTGAATGCAAAGGTCAGGGGAGG + Intronic
1071651770 10:87399138-87399160 TAAATGAGAGATGTCAGGGGAGG - Intergenic
1075703219 10:124482765-124482787 TGGGGTAGGAAGGTCAGGGGAGG - Intronic
1076284252 10:129277669-129277691 CAGATTAGAAAGGACAGAAGAGG + Intergenic
1076656465 10:132027084-132027106 TAGATAAGAAAGGTCAGGCATGG - Intergenic
1078198842 11:9161055-9161077 TAGTTAAGAAAGGCCAGGTGTGG + Intronic
1081599928 11:44485880-44485902 TGGTTTAGGAAGGCCAGGGGTGG - Intergenic
1084142933 11:67245728-67245750 TAGATTAGAAAGGACCGGGGAGG + Intronic
1085268658 11:75255189-75255211 TATAATGGAAAGGTCAGTGGAGG - Intergenic
1085883012 11:80489818-80489840 TAGATGAGAAAGTCCAGGAGGGG - Intergenic
1087303587 11:96463252-96463274 TAGCTTAGAGAGATCATGGGAGG + Intronic
1088844524 11:113653565-113653587 TAGATTAGGGTGGTCAGGGAAGG - Intergenic
1089638193 11:119829993-119830015 TGGATTATTAAAGTCAGGGGAGG - Intergenic
1089996485 11:122912783-122912805 TAGATGAGGAAGGTGAGGTGAGG - Intronic
1090421816 11:126580507-126580529 AAGTCTAGAAAGGTCAGTGGAGG + Intronic
1090525247 11:127527388-127527410 TAGATCTCAAAGGTCAAGGGGGG - Intergenic
1091722804 12:2825591-2825613 CAGCTGAGAAAGGGCAGGGGAGG + Exonic
1092419413 12:8317628-8317650 TGGTTTAGAAAGGGGAGGGGGGG + Intergenic
1095204795 12:39427213-39427235 TAAATTGGAATGGTCAGGGATGG + Intronic
1096099885 12:48963991-48964013 TAAATGAGGAAGGTCATGGGAGG + Intergenic
1100560665 12:95746388-95746410 TGGTTTAGAAAGGGGAGGGGGGG - Intronic
1100700581 12:97143522-97143544 TTGATCTGAAAGGTCAGGAGGGG + Intergenic
1101308903 12:103558194-103558216 TAGATTGGAAGGGTCAAGAGTGG - Intergenic
1101849621 12:108391850-108391872 AAGGTTGGAAAGGTCAGGAGGGG + Intergenic
1102211361 12:111129649-111129671 AGGACTAGAAAGATCAGGGGTGG - Intronic
1103710645 12:122910103-122910125 TAAAATAGACAGGCCAGGGGAGG - Intergenic
1108472110 13:50777833-50777855 AAGGTTAGAAAGGTGAGGGCAGG - Intronic
1109731101 13:66415224-66415246 TTGATTAGAAAGGTGAGGGATGG - Intronic
1111159037 13:84368990-84369012 AACATTAGAAAGGTCATTGGTGG + Intergenic
1112136454 13:96583798-96583820 TAGATAAGAGTGATCAGGGGAGG - Intronic
1113172023 13:107515254-107515276 AAGATTGGAAAGGTTAGGTGTGG + Intronic
1114794732 14:25700650-25700672 TAAATTAGTATGGTCAGGGAAGG - Intergenic
1115465008 14:33705742-33705764 TAGATTAGATATGGCAGTGGTGG + Intronic
1115613678 14:35072850-35072872 TAGATATGAAAGGAAAGGGGGGG - Intronic
1116643222 14:47492781-47492803 TAATTTAGCAAGGTCATGGGTGG - Intronic
1117101499 14:52353304-52353326 AAGAGTATAAAGGTCAGGTGTGG + Intergenic
1118848036 14:69562920-69562942 TGGATTCAAAAGGTCTGGGGTGG + Intergenic
1119830981 14:77702334-77702356 TAGAGTTGAAAGGTGAGGAGCGG + Intronic
1122483827 14:102065117-102065139 TGGTTTAGAAAGGGGAGGGGGGG - Intergenic
1123926149 15:25113628-25113650 TAAACTAGAAAGGCCGGGGGTGG + Intergenic
1124004350 15:25784460-25784482 TAAAATAGAAACTTCAGGGGAGG + Intronic
1124653421 15:31488935-31488957 CTGATTTGAGAGGTCAGGGGTGG + Intronic
1124897365 15:33789430-33789452 TGGATTAGCAGTGTCAGGGGTGG + Intronic
1126945110 15:53810644-53810666 TGGTTTAGAAAGGGGAGGGGGGG - Intergenic
1127944998 15:63742506-63742528 TAGAATAGAAATGGCAGGAGTGG + Intronic
1128761502 15:70219247-70219269 AGGGTCAGAAAGGTCAGGGGTGG + Intergenic
1129511623 15:76127920-76127942 TAAATTAGAAATTTCATGGGCGG + Intronic
1132152362 15:99471537-99471559 TAGAATAGAAAGGTGAAGGAAGG + Intergenic
1136144139 16:28305835-28305857 TATATAAGAAAGATCAGGGCTGG - Intronic
1137716066 16:50598969-50598991 TGGCTTAGAGAGGTCAGTGGTGG + Intronic
1137937602 16:52649480-52649502 AAAATTAGAAAGGGCATGGGTGG + Intergenic
1138643691 16:58407046-58407068 GAGAGGAGGAAGGTCAGGGGGGG - Intergenic
1138814299 16:60186651-60186673 TAGCTAAAACAGGTCAGGGGTGG + Intergenic
1139790343 16:69428939-69428961 GAGATCAGAATGATCAGGGGAGG + Intronic
1140035044 16:71365297-71365319 TAGATTAGAGAGGTCAAAGGAGG - Intronic
1141875695 16:86822727-86822749 GAGGTGGGAAAGGTCAGGGGTGG + Intergenic
1145725313 17:27115519-27115541 TAGATTAGGGATGTCAGTGGGGG + Intergenic
1146292112 17:31615908-31615930 TAGACTAAAAAGGCCAGGTGCGG - Intergenic
1147457129 17:40544939-40544961 TAAATTAGGAAGGTTAGGGTTGG + Intergenic
1148986764 17:51629155-51629177 AAGAGTGGAAAGGCCAGGGGAGG + Intergenic
1149167170 17:53766153-53766175 GAGAATAGAAGGATCAGGGGTGG + Intergenic
1150917348 17:69450241-69450263 AAGAATAGAAAGGCCAGGTGTGG - Intronic
1152376114 17:79919838-79919860 TAGAGTAGAAAGGGCACGTGAGG + Intergenic
1153933405 18:9899237-9899259 CAGTTTAGAAAGGGCAGAGGAGG + Intergenic
1154396760 18:13997844-13997866 TAGCTTAGAGAGGTAGGGGGTGG + Intergenic
1155371967 18:25111299-25111321 TAGATTAGTAAGGACAGTGTGGG - Intronic
1156121426 18:33847097-33847119 TGTACCAGAAAGGTCAGGGGAGG - Intergenic
1157213749 18:45764864-45764886 GAGACTAGAAGGGCCAGGGGTGG - Intergenic
1158587928 18:58757145-58757167 TAGAGTAGCCAGGTCAGAGGTGG - Intergenic
1159084480 18:63773216-63773238 TAGATTAGAAAGGTTAGATTTGG + Intronic
1161423216 19:4187109-4187131 AAGATTAGAAAGGGAAGGGGAGG + Intronic
1162078227 19:8203162-8203184 TGGTTTAGAAAGGGGAGGGGGGG + Intronic
1165252617 19:34552856-34552878 TGGTTTAGAAAGGAGAGGGGGGG + Intergenic
1165522403 19:36325011-36325033 TGGTTTAGAAAGGAGAGGGGGGG + Intergenic
1165523225 19:36330625-36330647 TGGTTTAGAAAGGGGAGGGGAGG + Intergenic
1165658567 19:37554880-37554902 TGGTTTAGAAAGGGGAGGGGAGG + Intronic
1168558329 19:57362285-57362307 TGGATGAGAGGGGTCAGGGGTGG - Intergenic
1168615082 19:57830900-57830922 TGGTTTAGAAAGGGGAGGGGGGG + Intronic
1168665639 19:58202972-58202994 TACATTAGAAAGGGGTGGGGTGG + Intronic
1168672470 19:58251071-58251093 TAGAATAGGAACTTCAGGGGTGG + Intronic
926007289 2:9382272-9382294 TAAATGAGACAGGTCAGGTGTGG - Intronic
926543431 2:14209101-14209123 TTGATTAGGAAGGTGAGGGGGGG - Intergenic
927832029 2:26359697-26359719 TAGATGATATAGGGCAGGGGAGG + Intronic
928391168 2:30912091-30912113 TTGATAAGAGAGGTCAGGAGAGG - Intronic
928977245 2:37101109-37101131 TATATTTGAAAGGTCAGAAGTGG - Exonic
932476003 2:72006307-72006329 TGGACTAGAAAGGCCAGGGAAGG + Intergenic
932548813 2:72744994-72745016 TAGATGAGAAAGTTGAGGGTCGG - Intronic
933639662 2:84745970-84745992 TAGATTAGAGAGATGAAGGGGGG + Intronic
934852786 2:97712088-97712110 TGGTTTAGAAAGGACAGGTGGGG + Intergenic
937727397 2:125183600-125183622 TAGATTAGAAAGGGAGGGAGTGG - Intergenic
938215002 2:129503909-129503931 AAGATTAGAGAGGGGAGGGGAGG + Intergenic
938835876 2:135103617-135103639 TAGATTAGAGAGAAGAGGGGAGG - Intronic
939143944 2:138390057-138390079 TAAAGTAGACAGGGCAGGGGTGG - Intergenic
939394427 2:141610555-141610577 TATGGTAGAAAGGGCAGGGGAGG - Intronic
939715000 2:145572627-145572649 TAGACTAGAAAGGCAAGGGTAGG + Intergenic
941161853 2:162044534-162044556 TAGAAAAGGAAGATCAGGGGTGG + Intronic
941749201 2:169117630-169117652 AATGCTAGAAAGGTCAGGGGTGG + Intergenic
942042930 2:172082902-172082924 TAGCTCAGAAAGGTCTAGGGAGG - Intergenic
942249957 2:174039133-174039155 TAGAATAGATCGGTCGGGGGTGG + Intergenic
942925005 2:181420975-181420997 AAGTTAAGAAAGGTCAGGAGAGG - Intergenic
944580283 2:201126178-201126200 TGGTTTAGAAAGGGGAGGGGGGG + Intronic
946349176 2:219137295-219137317 TAGACTAGGAAGATCATGGGTGG - Intronic
947612914 2:231534755-231534777 AAGGTTAAAAAGGTCAGGGCTGG - Intergenic
1169068635 20:2708293-2708315 TAGCTAATAAAGCTCAGGGGAGG + Intronic
1169570131 20:6897222-6897244 AAGAATAGTAAGGTCAGGTGCGG - Intergenic
1170125403 20:12957303-12957325 AAGATTAGAGAGGACAGGGAAGG + Intergenic
1170742718 20:19072319-19072341 TAAAATAGAAAGTTCAGAGGTGG - Intergenic
1175964006 20:62651202-62651224 TAGATTGGAAAGGGGAGGGTGGG - Intronic
1176843462 21:13858715-13858737 TGGTTTAGAAAGGGGAGGGGAGG - Intergenic
1176939301 21:14904504-14904526 TAGGGTAGAGAGGTCAGGGTGGG - Intergenic
1177957421 21:27616469-27616491 TAGAACAGAAAGGCCAGGCGCGG - Intergenic
1178134770 21:29614707-29614729 TATATTAGAAAGGTGGGGGCTGG - Intronic
1178478974 21:32962696-32962718 TACTTAAGAAAGGTCAGGGTGGG - Intergenic
1179669532 21:42936838-42936860 TGGTTTAGAAAGGGGAGGGGGGG - Intergenic
1179983827 21:44910437-44910459 TAGAGCAGGAAGGTCAGAGGAGG + Intronic
1181756806 22:25029685-25029707 CAGATGAGAAAGGTGAGGTGCGG + Intronic
1181991874 22:26843127-26843149 CAGATAAGAAAGGTCCAGGGAGG - Intergenic
1182433890 22:30317965-30317987 CATATTACAAAGGTCAGTGGTGG + Intronic
1182684750 22:32113376-32113398 AAAATCAGAAATGTCAGGGGAGG + Intergenic
950520589 3:13495521-13495543 GAGATAAGAAGGGTCTGGGGTGG - Intronic
952845508 3:37684757-37684779 TATGTTAGGAAGGCCAGGGGCGG - Intronic
953008150 3:38997041-38997063 TAGATTAGAGGGGGCAAGGGTGG - Intergenic
953760912 3:45686216-45686238 TGGTTTAGAAAGGGGAGGGGGGG - Exonic
954848752 3:53582584-53582606 TAGATGAGAAGGGTCACAGGTGG + Intronic
956559444 3:70558192-70558214 CAGAATAGAAAGGACATGGGGGG + Intergenic
956586188 3:70867436-70867458 TAGATTTGTAGGGTCAGAGGTGG + Intergenic
956815267 3:72902694-72902716 TAAATAAGAAAGGCCAGGTGCGG + Intronic
957682551 3:83456003-83456025 TAGATAAGAAAGCACAGGGCTGG - Intergenic
957891956 3:86370848-86370870 TAGATTATAAAAATCAGTGGAGG - Intergenic
958932175 3:100219117-100219139 TACAGTAGACAGGTCAGGGAAGG + Intergenic
959161219 3:102726477-102726499 TAAATTATAAAGGTCTGGAGGGG + Intergenic
959521147 3:107324297-107324319 GAGATCAGAGAGGTGAGGGGTGG - Intergenic
961328980 3:126127912-126127934 TAGATTAGAGAGGGCAGGCTGGG + Intronic
962044445 3:131740666-131740688 TAGTTTAAAGAGGACAGGGGAGG - Intronic
965553792 3:169998929-169998951 CAGATTAGGAAGGTCAGGAAAGG + Intergenic
965683894 3:171281251-171281273 TATATGAGAAAGGGCATGGGAGG - Intronic
965965895 3:174488827-174488849 TAGCTTCCAAAGGTTAGGGGGGG - Intronic
967369851 3:188731810-188731832 AAGATTAGACAGGCCAGGCGCGG - Intronic
967903296 3:194479080-194479102 GAGATTAGAAAGGATTGGGGCGG + Intronic
968401560 4:303230-303252 TGGTTTAGAAAGGGGAGGGGGGG - Intronic
969978147 4:11126096-11126118 TAGATTAGAGAGGTAGGAGGTGG - Intergenic
970720580 4:18984037-18984059 TAGATTATAAAGCACAGGCGTGG + Intergenic
971820918 4:31554015-31554037 TAGATTTGAGGGGTAAGGGGAGG - Intergenic
972858295 4:43135367-43135389 TAAATATGAAAGGTCAGTGGAGG + Intergenic
973566137 4:52189546-52189568 TGATTTAGAAAGGTCTGGGGTGG + Intergenic
973767124 4:54172963-54172985 AAGAAAAGAAAGGTCAGGTGTGG - Intronic
975905718 4:79209747-79209769 TAGATTACATTGGTCAGGGCTGG + Intergenic
976070755 4:81237009-81237031 TGGAGTAGAAAGGTAAGGGAAGG - Intergenic
977964480 4:103128053-103128075 TAGATTAGAAAGTAAAGGGATGG + Intronic
979258116 4:118625270-118625292 TTAACTAGAATGGTCAGGGGTGG + Intergenic
979330230 4:119415298-119415320 TTGACTAGAATGGTCAGGGGTGG - Intergenic
980663571 4:135899284-135899306 AAGAATAGAATGGTCTGGGGAGG + Intergenic
980698995 4:136398240-136398262 TAGAGATGAAAGGTCAGGGAGGG - Intergenic
981553974 4:145971762-145971784 TACATTAGAAAGGCCAGGCATGG + Intergenic
981772447 4:148325764-148325786 TTGATTACATAGGTAAGGGGAGG - Intronic
981861707 4:149363160-149363182 TAGGGTAGAAATGTCAGGAGAGG + Intergenic
984443651 4:179805719-179805741 TAAATAAGAAAGGCCAGGCGCGG + Intergenic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
987418586 5:17691568-17691590 GAGATGAGAAAGGTCAGAGCAGG - Intergenic
988616122 5:32776880-32776902 TAGTTTAGAGTGGTCAGGGAAGG + Intronic
989658843 5:43776306-43776328 TAGATTAGGAGGGTTAGGTGAGG + Intergenic
990473472 5:56139663-56139685 TTGAGAGGAAAGGTCAGGGGTGG + Intronic
990772352 5:59262971-59262993 TAGATTAGAATTGCCAGTGGTGG + Intronic
991270221 5:64770294-64770316 TAAATAAGATAGGTGAGGGGTGG - Intronic
993494709 5:88594682-88594704 GAGATCAGAGAGGTCATGGGAGG + Intergenic
994002581 5:94797753-94797775 TAGATTATAAATGTGAGGGAAGG - Intronic
998328769 5:141305066-141305088 TAGATAAGACAGGCCAGGTGTGG + Intergenic
998572660 5:143277484-143277506 TAGAATAGAAAGGTCGGGCAGGG - Intergenic
998918533 5:147042224-147042246 TGGTTTAGAAAGGGGAGGGGGGG - Intronic
999537794 5:152536679-152536701 TAAATCAGAAAGGTCAAGTGAGG - Intergenic
1000623301 5:163509499-163509521 TAGATCACAAAGGTCTGGGGTGG - Intronic
1004553375 6:16672066-16672088 TATGTTAAATAGGTCAGGGGTGG - Intronic
1006725185 6:36194528-36194550 TTTATTGGAAAGGCCAGGGGTGG + Intergenic
1008518611 6:52342193-52342215 TAGATGCCAAAGGTTAGGGGAGG - Intergenic
1009928340 6:70146968-70146990 AAGAATAGAAAGGTCAGAGACGG + Intronic
1010987765 6:82444970-82444992 TAGATTCTAAAAGTGAGGGGGGG + Intergenic
1014895976 6:126899516-126899538 TAGAATAAAAAGGTAAAGGGTGG + Intergenic
1017815048 6:158010460-158010482 TACATCAGAAGGGTCGGGGGAGG + Intronic
1018146105 6:160890503-160890525 TGGTTTAGAAAGGGGAGGGGGGG + Intergenic
1020075488 7:5255308-5255330 TAGATTAGAAAAAACAGTGGTGG + Intergenic
1022024866 7:26438246-26438268 TACTTTAGAAAGGTCATGTGTGG - Intergenic
1022052267 7:26688383-26688405 TACATTAGAAAAGTCTGTGGTGG + Intronic
1022560660 7:31345838-31345860 TAAATTAGGAGGGCCAGGGGAGG - Intergenic
1022867737 7:34439695-34439717 TAGATTTGAATGGCCAGGTGTGG + Intergenic
1023106762 7:36770532-36770554 TATATTAGAATGCTCAGGGTGGG + Intergenic
1023400101 7:39786563-39786585 TTAAATAGAATGGTCAGGGGTGG + Intergenic
1024073030 7:45802313-45802335 TTAAATAGAATGGTCAGGGGTGG + Intergenic
1024650303 7:51397871-51397893 TTAAATAGAATGGTCAGGGGTGG - Intergenic
1025054446 7:55753524-55753546 TTAAATAGAATGGTCAGGGGTGG - Intergenic
1025132498 7:56383676-56383698 TTAAATAGAATGGTCAGGGGTGG - Intergenic
1025203588 7:56978254-56978276 TAGATTAGAAAAAACAGTGGTGG - Intergenic
1025668354 7:63598674-63598696 TAGATTAGAAAAAACAGTGGTGG + Intergenic
1026385841 7:69846872-69846894 TAGATTAGAAAGCTGATGTGGGG - Intronic
1030394532 7:108968973-108968995 TAGATTCAACAGGTCTGGGGTGG + Intergenic
1031153662 7:118083969-118083991 TATATGAAAAAGGTCAGGGTGGG + Intergenic
1031184570 7:118460250-118460272 CAGATTAGAAAGGTGAGGATAGG + Intergenic
1032143622 7:129358101-129358123 TAAAAAAGAAAGGCCAGGGGCGG + Intronic
1033165763 7:139037417-139037439 TAGATTTGAGAGGTCAGGAAAGG - Intergenic
1033171922 7:139092008-139092030 TGGTTTAGAAAGGGGAGGGGGGG + Intronic
1035128717 7:156630705-156630727 AAATTTGGAAAGGTCAGGGGAGG + Intergenic
1037717030 8:21409408-21409430 TAGAGGAGAGAGGTAAGGGGAGG - Intergenic
1038118546 8:24585581-24585603 TAGCTTAGAAAGATCAGGTAAGG + Intergenic
1038517243 8:28197431-28197453 CAAATCATAAAGGTCAGGGGAGG + Intergenic
1038640391 8:29319945-29319967 TGGTTTAGAAAGGGGAGGGGGGG - Intergenic
1038692783 8:29778298-29778320 TAGAAAAGAAAGGTGAGTGGAGG + Intergenic
1039565631 8:38550418-38550440 AAGATTAGGAAGGCCAGGCGCGG - Intergenic
1039717379 8:40124430-40124452 TAGCTTAGAGTGTTCAGGGGAGG + Intergenic
1040767727 8:50935053-50935075 GTGATAAGAAATGTCAGGGGTGG - Intergenic
1041278371 8:56187009-56187031 TAGTTTAGGAAGGTCAGGCCAGG - Intronic
1044788302 8:95820024-95820046 TAGATAAGAAGGATGAGGGGTGG + Intergenic
1045357962 8:101406001-101406023 TATAATAGAGAGGGCAGGGGAGG - Intergenic
1045436902 8:102172961-102172983 GAGATTTGGAGGGTCAGGGGAGG - Intergenic
1045784676 8:105906740-105906762 TACATTAGAAAGTCCAGGGGAGG + Intergenic
1046886121 8:119369007-119369029 TAGAGAATAAATGTCAGGGGTGG - Intergenic
1047953256 8:129953245-129953267 CAGCTTGGGAAGGTCAGGGGAGG + Intronic
1048771720 8:137902574-137902596 TAGAGAAGAAAGGTCAGCAGAGG - Intergenic
1050538530 9:6650399-6650421 TAGAGCAGAACGGGCAGGGGAGG - Intergenic
1050720026 9:8577634-8577656 TATGTTAGAGAAGTCAGGGGAGG - Intronic
1051081661 9:13301140-13301162 TACATTAGAAAGTTATGGGGTGG + Intergenic
1051656316 9:19385330-19385352 TAGATTTGAAAGCTCAGTGTTGG + Intergenic
1051715399 9:19977796-19977818 TAGAATAAAAAGGTCAGAGAAGG + Intergenic
1051745760 9:20293349-20293371 GAGATGAGAGAGGTCAGGGAAGG - Intergenic
1054329511 9:63738170-63738192 GAGATTTGAAGGGTCAGGGATGG - Intergenic
1058590430 9:106559227-106559249 AATATGAGAAAGGTCAGGTGGGG - Intergenic
1058933969 9:109750492-109750514 TGAATTAGAATGGTCAAGGGTGG + Intronic
1060124244 9:121026740-121026762 TAGTGTAGAAGAGTCAGGGGAGG + Intronic
1060289454 9:122287099-122287121 TAGATTGGAGAGGTCAGGAAAGG - Intronic
1061704421 9:132441882-132441904 ATGATTAGGAAGGTCTGGGGTGG - Intronic
1062589764 9:137268283-137268305 TAGTGTAGAAAGGGCAGGGACGG + Intronic
1203678245 Un_KI270756v1:41595-41617 TAGAATGGAATGGTCAGGAGGGG - Intergenic
1187129008 X:16482741-16482763 TAGGTTAAAAAGCTCAGGCGAGG + Intergenic
1189053423 X:37671527-37671549 GAGATTAGAGAGGTAATGGGAGG - Intronic
1192817782 X:74613102-74613124 CAGTTTAGAAAAGTCATGGGGGG + Intronic
1193041255 X:77006137-77006159 TGAATTAGAATGGTCAGGGAAGG + Intergenic
1195894178 X:109728918-109728940 AAGAATAAAAAGGCCAGGGGCGG + Intronic
1196740372 X:119019909-119019931 TAGATTAGAAAACTGAGGGTTGG - Intergenic
1199165421 X:144667869-144667891 AAGACAAGAAAGGCCAGGGGTGG + Intergenic
1201110976 Y:10799257-10799279 TAGATTGGAGTGGTCAGGAGTGG - Intergenic
1201731081 Y:17203945-17203967 TAGATTATAATTGTCAGGGATGG + Intergenic