ID: 1064591530

View in Genome Browser
Species Human (GRCh38)
Location 10:16897495-16897517
Sequence TTTCCCCTACCAATACCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064591525_1064591530 26 Left 1064591525 10:16897446-16897468 CCTGAGGGACTCTGTGTGTTTCT 0: 1
1: 0
2: 1
3: 20
4: 227
Right 1064591530 10:16897495-16897517 TTTCCCCTACCAATACCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064591530 Original CRISPR TTTCCCCTACCAATACCCCC GGG Intronic
No off target data available for this crispr