ID: 1064594715

View in Genome Browser
Species Human (GRCh38)
Location 10:16932006-16932028
Sequence AGGAAGGCTTAGATGTGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064594712_1064594715 12 Left 1064594712 10:16931971-16931993 CCATTACATGAAAAGTTTTAAAT No data
Right 1064594715 10:16932006-16932028 AGGAAGGCTTAGATGTGAAGAGG No data
1064594711_1064594715 17 Left 1064594711 10:16931966-16931988 CCTTTCCATTACATGAAAAGTTT 0: 1
1: 0
2: 1
3: 27
4: 362
Right 1064594715 10:16932006-16932028 AGGAAGGCTTAGATGTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064594715 Original CRISPR AGGAAGGCTTAGATGTGAAG AGG Intronic
No off target data available for this crispr