ID: 1064600022

View in Genome Browser
Species Human (GRCh38)
Location 10:16984272-16984294
Sequence TACATCCCATGTTAGATCTA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064600022_1064600025 28 Left 1064600022 10:16984272-16984294 CCATAGATCTAACATGGGATGTA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1064600025 10:16984323-16984345 GCAATTACAGGCCCTTGCTCTGG No data
1064600022_1064600024 16 Left 1064600022 10:16984272-16984294 CCATAGATCTAACATGGGATGTA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1064600024 10:16984311-16984333 AAAATATTTTAAGCAATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064600022 Original CRISPR TACATCCCATGTTAGATCTA TGG (reversed) Exonic
901892614 1:12280452-12280474 TACATCACATGCTAGATTTAAGG - Intronic
906747850 1:48234145-48234167 TACATCCCGAGTTAAATCTTAGG + Intronic
906846468 1:49198063-49198085 TGCTTCCCAAGTTAGATCCAGGG + Intronic
908421802 1:63966034-63966056 TAAATCCGATGTTAGAGCTTGGG + Intronic
909140596 1:71859663-71859685 TGCATACTATGTTGGATCTAGGG - Intronic
912102872 1:106233546-106233568 TAGATCCCATGTTAGAGCAGAGG - Intergenic
916332635 1:163634436-163634458 TACTTCCCAAGTTATATCCAGGG + Intergenic
922308461 1:224365528-224365550 GACATCCCAAATTAGAGCTAGGG + Intronic
922333819 1:224602231-224602253 TACATTGCATTTTAGATTTATGG - Intronic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1066406007 10:35119086-35119108 TCCATCCAATGTTAGATAAAAGG - Intergenic
1067908662 10:50321194-50321216 TACATCAAATGTTAAATATAAGG + Intronic
1068308304 10:55244466-55244488 TAAACCCCATGTGAGATTTATGG + Intronic
1070281330 10:75050996-75051018 TCCATCCCAGGTTAGCTCAAGGG - Intronic
1071263173 10:83939556-83939578 TCCATGCCATTTAAGATCTATGG + Intergenic
1072000118 10:91186695-91186717 TACATCCCTAGTTGAATCTAGGG - Intronic
1073938909 10:108670737-108670759 TACAACCCATTTTAATTCTAGGG + Intergenic
1074924168 10:118049909-118049931 TACATACCATGTTACTTCTTGGG - Intergenic
1090439776 11:126715966-126715988 TACACCCAATGTTAGTTCTTAGG + Intronic
1095145770 12:38724097-38724119 TACTTCCCATTTTAGATAAAAGG + Intronic
1095866931 12:46982868-46982890 TTCATCCCAAGTTAGCTCCAGGG - Intergenic
1096935972 12:55276746-55276768 TAAATCCCATATCAGATATAAGG - Intergenic
1100002024 12:89848816-89848838 TAAAGCCCATTTTAGATTTATGG - Intergenic
1108151909 13:47544887-47544909 TCCATCCTAGGTCAGATCTATGG - Intergenic
1109895891 13:68689486-68689508 TTCATCCCACTTCAGATCTAAGG + Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118659729 14:67995518-67995540 TCCATCCCAAGTTAGAAATATGG + Intronic
1202850595 14_GL000225v1_random:15503-15525 TACATCACATGTTTGATCAGTGG + Intergenic
1202864446 14_GL000225v1_random:105925-105947 TACATCACCTGTTTGATCTGCGG + Intergenic
1126817233 15:52466064-52466086 TGCTCCGCATGTTAGATCTAGGG - Intronic
1130652534 15:85770241-85770263 TAAGTCCCATTTTAGAGCTAGGG + Intronic
1135285168 16:21187137-21187159 TACCTCCCATTTTAGAGATAAGG + Intergenic
1138489746 16:57369853-57369875 TGCATCCCATTTTACATATAGGG + Intergenic
1139029388 16:62860606-62860628 AACATGCCATGTCAGATGTATGG - Intergenic
1156557979 18:38089022-38089044 TTAATCCTATGTTAAATCTATGG + Intergenic
1168633111 19:57972618-57972640 CACATCCCATCTTAGATATTTGG - Intronic
931459367 2:62436995-62437017 TACATCCCATGTTCACTCTGGGG + Intergenic
931487489 2:62707005-62707027 TAAATCCCATCTTAGATGAATGG - Exonic
933209264 2:79548013-79548035 TACATCCCTTGGTATACCTAAGG - Intronic
934122458 2:88853459-88853481 TGGGTCCCATGGTAGATCTAGGG - Intergenic
935275635 2:101473816-101473838 AACATCCCATCCTGGATCTAGGG + Intronic
938228655 2:129639050-129639072 TACTTCCCATTTTACATATAAGG - Intergenic
938228904 2:129640876-129640898 TACTTCCCATTTTACATGTAAGG + Intergenic
938639319 2:133263998-133264020 TTCATCCCATTTTAGATCCTAGG + Intronic
942076834 2:172363924-172363946 TAGATCCTATGGTAGGTCTAGGG + Intergenic
1169005692 20:2205512-2205534 TACATACCATGACAGAACTATGG + Intergenic
1169960677 20:11156391-11156413 TAAATCTCATGGTAGATTTAGGG + Intergenic
1172849931 20:37954245-37954267 TACATCCCATGTTCACTTTAGGG - Intergenic
1173096141 20:40030399-40030421 TAGATACCATGTTAGATGTTGGG - Intergenic
1183492947 22:38126515-38126537 CACAGCCCAGGTTTGATCTAGGG - Intronic
949275388 3:2273994-2274016 AACAACCCATGTTGGATCTTAGG + Intronic
952598374 3:35047082-35047104 TACATCCAATGTTAGAGATAAGG + Intergenic
957855345 3:85869514-85869536 GAAATCCCATATGAGATCTATGG - Intronic
958559485 3:95726975-95726997 TATATTCAATGTTATATCTAAGG - Intergenic
962183685 3:133235560-133235582 CACATCCCATTTTACATCTAGGG - Intronic
964491642 3:157242217-157242239 TCCATCCCATTCTAGATCTGAGG - Intergenic
965185611 3:165458866-165458888 TGTATCCCATGCTAGGTCTAAGG - Intergenic
965823179 3:172705416-172705438 TACATCCCATGTTACATGATGGG - Intronic
971458800 4:26871977-26871999 TGCATCCCATTTTAGAGATAAGG - Intronic
971820044 4:31539933-31539955 TCCTTCCCATGTTAGATCCAAGG + Intergenic
978335412 4:107662621-107662643 TATATCTCATGCTAGATTTAAGG - Intronic
987831298 5:23099157-23099179 TACATCATATGTTACATGTAGGG + Intergenic
995174973 5:109165761-109165783 TACATCCCATGTTCATTCTATGG + Intronic
998533128 5:142903441-142903463 TTTATCTCATTTTAGATCTAAGG + Intronic
999168505 5:149572285-149572307 TACATCCCATGTTACATAAGAGG - Intronic
999662641 5:153881728-153881750 TAGGTCACATGTTGGATCTAAGG - Intergenic
1002685455 5:181005798-181005820 TACATCGCATGCTGGATATAGGG - Exonic
1004745077 6:18501581-18501603 TCCATCCCAGGTTACCTCTACGG + Intergenic
1011633248 6:89347620-89347642 CACATACCATGTAAGAGCTAAGG + Intronic
1012292192 6:97470411-97470433 TACATCCACTGTTAGTTTTATGG - Intergenic
1013764424 6:113558290-113558312 TACACCCCAAGTTAGAGCAAAGG + Intergenic
1031692776 7:124811094-124811116 TAGATCACATGTTAGATGAAAGG + Intergenic
1033182936 7:139198585-139198607 TTCATTCGATGTTATATCTATGG + Intergenic
1035760986 8:2068687-2068709 TCCATCCCATGCGAGTTCTAAGG - Intronic
1039242836 8:35575372-35575394 CAGATGCCATGTTAGATCCATGG - Intronic
1040750402 8:50698776-50698798 CACATCCCAAGGTAGATCTAGGG + Intronic
1043110486 8:76173726-76173748 TACCTCAAATGTTTGATCTATGG - Intergenic
1045799970 8:106090707-106090729 TATATGCTATGTTAGATTTAAGG + Intergenic
1049634742 8:143681558-143681580 TACATCCTAGGTTAGAGCTCAGG + Intergenic
1050766096 9:9135710-9135732 TATATCCTATGTTAGAACTTTGG + Intronic
1056260301 9:84841889-84841911 AACATCCCAGGTTGAATCTAGGG + Intronic
1058123781 9:101168365-101168387 AACATCCCATATCATATCTATGG - Intronic
1058130368 9:101245801-101245823 TACAGACCATGTTAGTTCTTTGG - Intronic
1203739878 Un_GL000216v2:170092-170114 TACATCACCTGTTTGATCTGCGG - Intergenic
1186298897 X:8177649-8177671 AACATTACAGGTTAGATCTATGG + Intergenic
1186329979 X:8521919-8521941 TACATAGCTTGTTAAATCTATGG - Intergenic
1188444622 X:30243163-30243185 CCCAACCCATGTGAGATCTAAGG + Exonic
1192146713 X:68687550-68687572 TCAATTCCATGTTAAATCTATGG - Intronic
1195684923 X:107576880-107576902 TACTTCACATATTAGACCTAAGG + Intronic
1201439644 Y:13993933-13993955 AACATTACAGGTTAGATCTATGG + Intergenic
1201444927 Y:14048775-14048797 AACATTACAGGTTAGATCTATGG - Intergenic