ID: 1064600024

View in Genome Browser
Species Human (GRCh38)
Location 10:16984311-16984333
Sequence AAAATATTTTAAGCAATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064600021_1064600024 19 Left 1064600021 10:16984269-16984291 CCTCCATAGATCTAACATGGGAT 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1064600024 10:16984311-16984333 AAAATATTTTAAGCAATTACAGG No data
1064600022_1064600024 16 Left 1064600022 10:16984272-16984294 CCATAGATCTAACATGGGATGTA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1064600024 10:16984311-16984333 AAAATATTTTAAGCAATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064600024 Original CRISPR AAAATATTTTAAGCAATTAC AGG Intronic
No off target data available for this crispr