ID: 1064600025

View in Genome Browser
Species Human (GRCh38)
Location 10:16984323-16984345
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064600022_1064600025 28 Left 1064600022 10:16984272-16984294 CCATAGATCTAACATGGGATGTA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1064600025 10:16984323-16984345 GCAATTACAGGCCCTTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr