ID: 1064602894

View in Genome Browser
Species Human (GRCh38)
Location 10:17011381-17011403
Sequence GACCTTCACCATGAGTGTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064602891_1064602894 24 Left 1064602891 10:17011334-17011356 CCTTCCAGTGGGTTCGTGGTCTC 0: 64
1: 480
2: 1743
3: 2270
4: 1695
Right 1064602894 10:17011381-17011403 GACCTTCACCATGAGTGTTACGG No data
1064602892_1064602894 20 Left 1064602892 10:17011338-17011360 CCAGTGGGTTCGTGGTCTCGCTG 0: 276
1: 962
2: 1156
3: 625
4: 291
Right 1064602894 10:17011381-17011403 GACCTTCACCATGAGTGTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064602894 Original CRISPR GACCTTCACCATGAGTGTTA CGG Intronic
No off target data available for this crispr