ID: 1064606698

View in Genome Browser
Species Human (GRCh38)
Location 10:17049310-17049332
Sequence GGCCAAAGCTCTCTGTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064606698_1064606701 -2 Left 1064606698 10:17049310-17049332 CCCACACACAGAGAGCTTTGGCC 0: 1
1: 0
2: 0
3: 19
4: 158
Right 1064606701 10:17049331-17049353 CCAGTAAATCAAATATTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064606698 Original CRISPR GGCCAAAGCTCTCTGTGTGT GGG (reversed) Intronic
900287060 1:1906870-1906892 GGCTGAAGCTCTCTGGGGGTAGG + Intergenic
902946749 1:19846266-19846288 GGCCAGAGATCTCTGTGCCTGGG - Intergenic
905233118 1:36527753-36527775 GGCCAGAACTCTCTTTCTGTCGG + Intergenic
907305473 1:53510578-53510600 GGGCAAAGCTCTCTGAGCCTTGG - Intronic
909203619 1:72725464-72725486 TGCCAAAGCTCTGAGTGTGATGG - Intergenic
910342872 1:86208059-86208081 AGCCAAATCCATCTGTGTGTAGG - Intergenic
910844500 1:91592513-91592535 AGCCAAAGCCCTCTGTGATTCGG + Intergenic
910956867 1:92715831-92715853 GAGCAAAGCTCTGTGGGTGTGGG - Intronic
913122553 1:115755050-115755072 AGCCACAGCTCTCAATGTGTGGG - Intronic
916844257 1:168632208-168632230 GGCCAAACCTGTCTGTTTGTTGG - Intergenic
918448711 1:184639247-184639269 GCCCAAAGCTCTGAGAGTGTCGG + Intergenic
920045929 1:203132350-203132372 GACCAAACCTCTCTGTGGGAAGG + Intronic
1064606698 10:17049310-17049332 GGCCAAAGCTCTCTGTGTGTGGG - Intronic
1067941776 10:50662614-50662636 GGCCACAGCTGTCTTTGGGTAGG - Intergenic
1070863023 10:79687572-79687594 GGCCACAGCTGTCTTTGGGTAGG - Intergenic
1072460070 10:95610628-95610650 GTACAAAACTCTCTGTGTCTGGG + Intronic
1073138154 10:101230842-101230864 GGCCAGGGCTGTGTGTGTGTGGG - Intergenic
1073441016 10:103552803-103552825 GGCCATGGCTCTCTCTGTATAGG + Intronic
1073991141 10:109263221-109263243 TGTCACAGCTCTCTGTGTGGTGG - Intergenic
1079171725 11:18102932-18102954 GGCCAGAGCTCTCTTTAGGTAGG + Intronic
1080909078 11:36576712-36576734 GAGCAAAGATCTGTGTGTGTTGG + Exonic
1081241420 11:40710965-40710987 GGGCAAGGCTCTGTGGGTGTGGG + Intronic
1081566849 11:44265599-44265621 GGCCAAAGCTCTCCGAGTTGAGG - Intronic
1082820634 11:57542561-57542583 GGCCAGAGCTCTCTGAGGGTGGG + Intergenic
1086365179 11:86101808-86101830 CGCCAAAGCTCTCAGGGAGTAGG + Intergenic
1091810313 12:3391454-3391476 GGCAAAATCACTCTGTGTGTGGG + Intronic
1091840457 12:3616814-3616836 GGCCAGAGCCCTCTGAGTATAGG - Intronic
1098345101 12:69494278-69494300 GGCCAGAGCTCTGTCTGTGATGG + Intronic
1100249484 12:92803112-92803134 AGACAAAGTTCTCTCTGTGTTGG - Intronic
1101411629 12:104473561-104473583 GACCCAAGTTCACTGTGTGTGGG + Intronic
1103257195 12:119551878-119551900 GGCAATTTCTCTCTGTGTGTTGG - Intergenic
1114672067 14:24416707-24416729 GGCCACAGCCGTGTGTGTGTAGG - Exonic
1121532528 14:94666585-94666607 GTCCAAAGTTCTTTGCGTGTAGG - Intergenic
1122960086 14:105090279-105090301 GGCCCAAGGTGTCCGTGTGTTGG - Intergenic
1123183586 14:106492366-106492388 GGAGAAAGGTCTCTGAGTGTGGG - Intergenic
1123965818 15:25456312-25456334 GGATAAAGCTCTCTGACTGTGGG + Intergenic
1125508628 15:40281506-40281528 GGCCAACGCTCTGTCTGTCTCGG - Exonic
1126373914 15:47975378-47975400 GGCCAAAGGGCTCTGTGGATGGG + Intergenic
1130013202 15:80168197-80168219 GGCCACAGAACTCTCTGTGTGGG - Intronic
1132393799 15:101457740-101457762 GGCCAGGGCTGCCTGTGTGTGGG - Intronic
1133274055 16:4625970-4625992 GGCCAGATTTCTCTGAGTGTGGG + Intronic
1134324482 16:13194437-13194459 GGCCAAACCTCTCTGTGCCTTGG + Intronic
1136939170 16:34504050-34504072 GGCCAAATCTCTCCTTGTCTTGG - Intergenic
1138249903 16:55493842-55493864 GGCCAAATTACTCTGTGTATGGG + Intronic
1138423251 16:56913426-56913448 GTCCACAGCTCTGAGTGTGTGGG + Exonic
1139066170 16:63317779-63317801 AGCCAAACAGCTCTGTGTGTCGG + Intergenic
1139868016 16:70079227-70079249 GGACACAGCACTCTGTCTGTGGG + Intergenic
1140387320 16:74552626-74552648 GGACACAGCACTCTGTCTGTGGG - Intronic
1142790420 17:2259944-2259966 AGCCAAAGCTCCCTGTGTGCTGG - Intronic
1147870436 17:43583296-43583318 GACCAAGGCTCTCTGTGGCTGGG + Intergenic
1150068825 17:62135275-62135297 GGGCAAAGCTTTCTATGTGATGG - Intergenic
1153314754 18:3710896-3710918 GGTCAGAGCTCTCCATGTGTGGG + Intronic
1155219624 18:23672350-23672372 GGGCACAGCACTCTGTCTGTAGG + Intergenic
1155269440 18:24125453-24125475 AACCAAAGCGCTCTGTGTGTTGG + Exonic
1156922279 18:42536286-42536308 GGCTAATGCTCTTTGTGTCTTGG + Intergenic
1157182986 18:45513913-45513935 AGGCAGAGCACTCTGTGTGTTGG - Intronic
1162185109 19:8898690-8898712 GGGCTAAGGTCCCTGTGTGTGGG + Intronic
1163225201 19:15955688-15955710 GGCCAAGGCTCCCTGTGTCCAGG - Intergenic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1164600826 19:29562240-29562262 GGCCATAGCTGTCTGTGTCATGG - Intronic
1165741296 19:38206715-38206737 GGCCTCACCTCTCTGGGTGTGGG - Exonic
1165963277 19:39553119-39553141 GGGCAAAGCACACGGTGTGTTGG - Intergenic
1168431688 19:56286607-56286629 TGCCAAGGCTCTTTGTGTGAAGG + Intronic
1168444427 19:56399603-56399625 GGTCAAAGCTCTCCTTGTGTGGG + Intronic
926720693 2:15958051-15958073 CCCTAAAGCTCTCTGGGTGTGGG + Intergenic
928211076 2:29324134-29324156 GGCCAAATCGCGCTGTGGGTAGG + Intronic
929378857 2:41324932-41324954 AGGCAGAGCTCTCTGGGTGTGGG - Intergenic
930549565 2:52815268-52815290 GCCCCAAGCTCTCTGCATGTTGG + Intergenic
932459812 2:71874931-71874953 GGGCTATGCTTTCTGTGTGTAGG + Intergenic
933234048 2:79844658-79844680 GGCCAAAGGTCCCTCTCTGTTGG - Intronic
933589710 2:84218685-84218707 GCCCAAAGCTGGCTGTGTCTGGG + Intergenic
939803344 2:146740741-146740763 GGCAAAAGCTGGCTGTATGTTGG + Intergenic
941170313 2:162127984-162128006 AGCAAAAGCTCTCTCTGTCTTGG + Intergenic
941734431 2:168957238-168957260 AGCCTAAGCTCTCTGTGCCTTGG + Intronic
943483591 2:188453639-188453661 GGCCATTGCTCTCTGTATCTTGG - Intronic
944319416 2:198320729-198320751 CGACAGAGCTCTCTGTGTCTTGG + Intronic
945045384 2:205776958-205776980 GTGAATAGCTCTCTGTGTGTGGG + Intronic
1168998914 20:2152548-2152570 GGTCACAGCTCTGGGTGTGTGGG + Intronic
1169340871 20:4795360-4795382 GACCAAAGCTCTCTGAATCTTGG - Intronic
1169569712 20:6892509-6892531 AGGCAAAGCTGTGTGTGTGTTGG + Intergenic
1170752855 20:19167450-19167472 GGGCAAGGCTCTGTGGGTGTGGG + Intergenic
1172510932 20:35500547-35500569 GGCCAAGGCTCTCTGTGATGAGG + Intronic
1172511090 20:35501562-35501584 GGCCAAGGCTCTCTGTGATGAGG + Intronic
1177609869 21:23432527-23432549 TGCCACAGCTCTCTCTGAGTTGG - Intergenic
1178284078 21:31310370-31310392 GGCCAAAGCTGGCTGGCTGTGGG - Intronic
1180641000 22:17299409-17299431 GAGCAAAGCTCTGTGGGTGTGGG + Intergenic
1181458496 22:23072592-23072614 GGCCAAAGCCAAGTGTGTGTTGG - Intronic
1182478937 22:30594016-30594038 GCACAAAGCATTCTGTGTGTGGG - Intronic
1184952367 22:47852923-47852945 GGGCAAAGCTAACTGTCTGTTGG + Intergenic
1185016394 22:48345698-48345720 GGCCTCTGCTCTCTGTCTGTCGG - Intergenic
1185028062 22:48426843-48426865 TCCCAAAGCTCTGTGTGTGCTGG + Intergenic
951705803 3:25543267-25543289 AGACAAAGCTCACTGTGAGTAGG + Intronic
952213863 3:31256089-31256111 GCCCACACCTCTCTGTATGTAGG - Intergenic
952765975 3:36954718-36954740 GGGCAAAGGTATCTGTGTGAGGG - Intergenic
953753442 3:45627122-45627144 GGCCACATTTCTCTGTGCGTAGG + Intronic
954617521 3:51976974-51976996 GCCAGAAGCTGTCTGTGTGTAGG + Intronic
954812657 3:53257548-53257570 AGCCAGAGCTCTCTGAGTATGGG - Intergenic
955340305 3:58120294-58120316 AGTCAAAGCTCTCAGTGTCTTGG - Intronic
959140086 3:102475223-102475245 GGACAAAAATCTCCGTGTGTGGG - Intronic
959188132 3:103073421-103073443 GACCAAGGCTCGCTCTGTGTTGG + Intergenic
961094925 3:124146119-124146141 GGCTTAAGATCTCTGTGTTTTGG - Intronic
961177939 3:124851333-124851355 GGCCAAAGTTTTCTTTGTGTAGG - Intronic
964120915 3:153182534-153182556 GGGAAAATCTCTCTGTGTTTAGG + Intergenic
964220138 3:154334099-154334121 GGCCAAACCTCTCTTTGGATAGG - Intergenic
968569224 4:1330769-1330791 GGCTGCAGTTCTCTGTGTGTTGG + Intronic
968673713 4:1865797-1865819 GGCCAAAACCCTCTGGCTGTGGG - Intergenic
969441552 4:7220125-7220147 GGCCTGAGCTGTCTGTGTGCTGG + Intronic
969781227 4:9405922-9405944 TGCCACAGCTGTCTGTGTCTGGG - Intergenic
972129948 4:35819995-35820017 AGCAAAAACTCTCTGTGGGTGGG + Intergenic
975291189 4:72679682-72679704 GGACAAGGCTCTGTGAGTGTGGG - Intergenic
979077898 4:116297804-116297826 GACCAAACCTCTCTGTTTATAGG - Intergenic
984661249 4:182378202-182378224 GGATAAATCTCTCTGTATGTTGG - Intronic
985553470 5:544678-544700 GGCCAATGCTCTTGGGGTGTGGG + Intergenic
988428114 5:31087594-31087616 GGCAAAAGCTCTCTCTTTTTTGG - Intergenic
989004001 5:36789569-36789591 TGCCAAATCTCCCTGTGTGATGG - Intergenic
989466262 5:41759058-41759080 GGACAAAGCTCTCTTTGCTTAGG - Intronic
990686153 5:58303275-58303297 GGCAAAAGTACTCTATGTGTTGG - Intergenic
992648073 5:78830755-78830777 GGAGAAAGCTATCTGTGTTTTGG + Intronic
993295826 5:86138556-86138578 GCCAAAAGCTCTCTATGGGTGGG - Intergenic
996256433 5:121409630-121409652 GGCAAAAGCTCTCTGTCACTAGG + Intergenic
997710697 5:136001603-136001625 GGCCATAGTTCTCAGAGTGTCGG - Intergenic
998448412 5:142216150-142216172 TGCCAAAGCTGTCTGTGGTTTGG + Intergenic
998502150 5:142642728-142642750 AGCCAAAGAGCTGTGTGTGTTGG + Intronic
1001213455 5:169832982-169833004 GGCCAAGGCTGCCTGTGTGCTGG + Intronic
1003081643 6:3025963-3025985 GGCCAACGCTGTCTATGTGTTGG - Intergenic
1013111214 6:107066741-107066763 GGCCACAGCTGTCTTTGGGTAGG + Exonic
1014816719 6:125943611-125943633 TTCCAAATCTCTCAGTGTGTTGG + Intergenic
1014989361 6:128054777-128054799 GGTCAAGGCTCTCTGAGGGTAGG - Intronic
1015625953 6:135181265-135181287 GTCCAAAGCTCTTTGTTTGATGG + Intergenic
1016516701 6:144901095-144901117 TACCAAACCTCTGTGTGTGTGGG - Intergenic
1020417487 7:7962536-7962558 GGCCCAAACCCTCTATGTGTTGG + Intronic
1020659511 7:10965865-10965887 GAGCAAGGCTCTGTGTGTGTTGG + Intergenic
1020659735 7:10967509-10967531 CACAGAAGCTCTCTGTGTGTTGG + Intergenic
1021452345 7:20794949-20794971 GGCCAAAGCTTTCGATGGGTAGG - Intergenic
1027961166 7:84947439-84947461 GCCCAAATCCCTCTTTGTGTGGG - Intergenic
1034076791 7:148239769-148239791 GGCCAGACCTCTCAGTGTGGAGG - Intronic
1034470106 7:151250340-151250362 GGCCCAGGCTCTGTGTGTGGGGG - Intronic
1034561630 7:151883598-151883620 GACTAAAGGTCTGTGTGTGTTGG + Intergenic
1035313673 7:157984901-157984923 GGCCCAGGCTCTCTGTGTAGAGG + Intronic
1037025236 8:14027750-14027772 GGCTACAGGTCTCTGTGTCTTGG - Intergenic
1038205590 8:25461739-25461761 AGCAAAAGCCATCTGTGTGTAGG + Intronic
1038290091 8:26241498-26241520 GGCTCAACCTCTCTGAGTGTCGG + Intergenic
1038422209 8:27440501-27440523 GTGCAAACCTCTCTGTGTGCTGG - Intronic
1039003818 8:33011507-33011529 GGCCAAACCTATCTGTTTATGGG - Intergenic
1041201365 8:55453891-55453913 GGCCTTTGCTCTCTTTGTGTTGG - Intronic
1044608882 8:94072561-94072583 GGCCAAAGCTTTGTTTGTCTGGG + Intergenic
1047489718 8:125364516-125364538 GGCCAGAGCTCTGTGTGGGCAGG + Intronic
1048360066 8:133689960-133689982 GTCCACATATCTCTGTGTGTAGG - Intergenic
1049736942 8:144213244-144213266 GTCCAAAGCTCTTTCTCTGTAGG + Intronic
1052418529 9:28209637-28209659 CGGTAAAGCTCTCTGTGTCTCGG + Intronic
1053097084 9:35338009-35338031 GGCCAATGCACTCTGTGGCTTGG + Intronic
1056815598 9:89798707-89798729 GGACAGAACTCTTTGTGTGTGGG + Intergenic
1060027646 9:120186458-120186480 GGCAGGAGCTGTCTGTGTGTGGG + Intergenic
1060938340 9:127528700-127528722 GGGCAAAGCCCACTGTGTGTGGG - Intronic
1060992340 9:127856343-127856365 GGCCAAATCTTTGTGTGTGCTGG + Intergenic
1203492099 Un_GL000224v1:116763-116785 GAACAAGGCTCTCTGGGTGTGGG + Intergenic
1203504723 Un_KI270741v1:58635-58657 GAACAAGGCTCTCTGGGTGTGGG + Intergenic
1185840255 X:3382976-3382998 GCCCAAAGTCCTCTGTGTGGAGG + Intergenic
1186073789 X:5853419-5853441 GTCCAAGTCTCTCTGTGTTTAGG - Intronic
1186907774 X:14130468-14130490 GTCCAAAACTCTATGTGTGTTGG - Intergenic
1189262907 X:39690311-39690333 GGGAAAAGCTCTCTGTGGGTGGG - Intergenic
1190171084 X:48112451-48112473 TGGGAAAGCTCTCTGTGTGTTGG - Intergenic
1190177185 X:48160184-48160206 TGGGAAAGCTCTCTGTGTGTTGG - Intergenic
1190181057 X:48193011-48193033 TGGGAAAGCTCTCTGTGTGTTGG + Intronic
1190183230 X:48212040-48212062 TGGGAAAGCTCTCTGTGTTTTGG - Intronic
1190189080 X:48261015-48261037 TGGGAAAGCTCTCTGTGTGTTGG - Intronic
1190194095 X:48302493-48302515 TGGGAAAGCTCTCTGTGTGTGGG + Intergenic
1190203925 X:48386555-48386577 TGGGAAAGCTCTCTGTGTGCTGG - Intronic
1190206611 X:48408848-48408870 TGGGAAAGCTCTCTGTGTGCTGG + Intronic
1190654648 X:52600346-52600368 TGGGAAAGCTCTCTCTGTGTTGG - Intergenic
1190655570 X:52609427-52609449 TGGGAAAGCTCTCTCTGTGTTGG + Intergenic
1190666761 X:52703360-52703382 TGGGAAAGCTCTCTGTGTGTTGG + Intronic
1190672657 X:52755048-52755070 TGGGAAAGCTCTCTGTGTGTTGG - Intronic
1192211632 X:69131530-69131552 GTGTAAAGCTCTCTGTCTGTGGG - Intergenic
1193718214 X:84957079-84957101 GGCCTAAGGTTTCTGTGTGGTGG + Intergenic
1199425288 X:147693576-147693598 GCCCCAAGGTATCTGTGTGTGGG - Intergenic
1201235716 Y:11908932-11908954 GCCCAAAGTCCTCTGTGTGGAGG - Intergenic
1201560258 Y:15308742-15308764 GGTCAAAGTTTTTTGTGTGTGGG + Intergenic