ID: 1064607517

View in Genome Browser
Species Human (GRCh38)
Location 10:17059316-17059338
Sequence CTGATATCATTGTTGCTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064607517_1064607523 30 Left 1064607517 10:17059316-17059338 CCACAAAGCAACAATGATATCAG 0: 1
1: 0
2: 2
3: 11
4: 233
Right 1064607523 10:17059369-17059391 TAAGCTGATCCTCTGGAGAGAGG No data
1064607517_1064607520 6 Left 1064607517 10:17059316-17059338 CCACAAAGCAACAATGATATCAG 0: 1
1: 0
2: 2
3: 11
4: 233
Right 1064607520 10:17059345-17059367 AAAATTTGAGCCACAGAAATAGG No data
1064607517_1064607522 23 Left 1064607517 10:17059316-17059338 CCACAAAGCAACAATGATATCAG 0: 1
1: 0
2: 2
3: 11
4: 233
Right 1064607522 10:17059362-17059384 AATAGGATAAGCTGATCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064607517 Original CRISPR CTGATATCATTGTTGCTTTG TGG (reversed) Intronic
900341698 1:2192551-2192573 CTGAGATCCTTGTTGCTGTCAGG - Intronic
904505274 1:30947761-30947783 ATGATATCTTAGTTGCTTTGAGG - Intronic
907262789 1:53234012-53234034 CTCTTAACACTGTTGCTTTGGGG - Intronic
909186712 1:72495881-72495903 TTGATATTATTGTTGGTTTCAGG - Intergenic
909234582 1:73136460-73136482 TTGATAACATTTTTCCTTTGTGG - Intergenic
909256748 1:73433275-73433297 CTCATATGATTTTTGCTTTATGG + Intergenic
909961191 1:81844865-81844887 CTGCCATAATTCTTGCTTTGAGG + Intronic
910174246 1:84412092-84412114 CTGATAACATGTTTGCTGTGAGG + Intronic
911409497 1:97484500-97484522 CTTATTTCATTGTGCCTTTGTGG + Intronic
911744766 1:101428637-101428659 CTGAGGTCATTGTAGATTTGAGG + Intergenic
912847247 1:113085641-113085663 CTGGAAGCATTTTTGCTTTGTGG - Intronic
916955305 1:169826793-169826815 GAGAAATCTTTGTTGCTTTGAGG - Intronic
916959746 1:169877103-169877125 CTGAAATGATTTTTGGTTTGGGG - Intronic
919482524 1:198107559-198107581 CTATTATCATTCTTGCTTTAAGG + Intergenic
919620162 1:199855954-199855976 CTGATAACATTGTCACTCTGAGG + Intergenic
921160541 1:212469160-212469182 TTGATTGCATTGTTGCTGTGAGG + Intergenic
921350827 1:214232727-214232749 CTGATATTATTGTTCCCTTCTGG - Intergenic
921444996 1:215235464-215235486 CTGGTAACAATGTAGCTTTGAGG + Exonic
921666614 1:217880217-217880239 CTAATATCATGTTTGCCTTGAGG + Intergenic
923972563 1:239220683-239220705 CTGACATCATTCTATCTTTGAGG - Intergenic
1064607517 10:17059316-17059338 CTGATATCATTGTTGCTTTGTGG - Intronic
1064967717 10:21031553-21031575 CTGTTAACATTTTTGTTTTGGGG - Intronic
1065948015 10:30625017-30625039 CTGAGATCCTTGTTGCTTGCAGG - Intronic
1066179693 10:32948545-32948567 CTCTCATCACTGTTGCTTTGGGG - Intronic
1066544345 10:36482891-36482913 CTTTTATCCTTGTTGCATTGCGG - Intergenic
1068614578 10:59099040-59099062 CTGGTAGCAGTGTTGCTCTGGGG + Intergenic
1073426592 10:103458890-103458912 CTGAGGTCACTGTCGCTTTGAGG + Intergenic
1073517683 10:104092095-104092117 CTCTTAACATTGTTGCATTGAGG - Intergenic
1074348491 10:112711826-112711848 CTGAGATGATGGCTGCTTTGTGG - Intronic
1075509362 10:123057536-123057558 CTGCCATCATTGTTAATTTGAGG + Exonic
1076571873 10:131438490-131438512 CTCATTTCCTTGTTTCTTTGTGG - Intergenic
1079387764 11:19996130-19996152 CTTATAGCACTGTGGCTTTGGGG - Intronic
1080016036 11:27507389-27507411 CTTATAAAATTGTTACTTTGTGG - Intergenic
1080312093 11:30906260-30906282 CTGTTCTCAGTGTTGCTTTTAGG - Intronic
1081583518 11:44368565-44368587 GTAATTTCATTTTTGCTTTGGGG - Intergenic
1082257088 11:50043228-50043250 CTGATAGCTTTGATGTTTTGTGG + Intergenic
1083978583 11:66145090-66145112 CTGGTATTATTGTTGTTTTGTGG - Intronic
1085830432 11:79895137-79895159 CTCTTAGCACTGTTGCTTTGGGG + Intergenic
1086216789 11:84392404-84392426 TGGATGTCATTTTTGCTTTGAGG - Intronic
1088073787 11:105821892-105821914 CTGATCTCACTGCTGCTTCGAGG + Intronic
1088199408 11:107315052-107315074 CTGATTTAATGGTTGCTTTTTGG - Intergenic
1088497797 11:110449324-110449346 CTAATATCAGTGTTGCTGTAAGG + Intronic
1089227639 11:116938744-116938766 TTGATATTTTTGTTGCTTTTAGG - Intronic
1090737559 11:129623553-129623575 CTGTTGTCATAGTGGCTTTGTGG - Intergenic
1090940299 11:131381675-131381697 CAGATGGCATTGTTGCCTTGGGG - Intronic
1092643957 12:10549538-10549560 CAGATATCAATGATGATTTGTGG - Intergenic
1093039057 12:14358584-14358606 CTGTCAACATTGTTGCATTGGGG + Intergenic
1094487082 12:30933841-30933863 TTGGGATCATTGTTGATTTGAGG + Intronic
1096903708 12:54913156-54913178 CTGACATCTTTGTTCCTCTGTGG - Intergenic
1096959096 12:55559735-55559757 CTGTTTTCCTTGTTTCTTTGAGG - Intergenic
1097364245 12:58693578-58693600 ATGATATTATTGTTGCTTTGGGG - Intronic
1099229531 12:80005750-80005772 TTGATAACATTTTTGCTTTCTGG + Intergenic
1100228935 12:92587559-92587581 CTGAAATCATTGTCTCTGTGTGG + Intergenic
1100240616 12:92707178-92707200 CTGAGATCTATTTTGCTTTGTGG - Intronic
1100361199 12:93881195-93881217 ATAAGATCTTTGTTGCTTTGGGG - Intronic
1106261587 13:28072038-28072060 TTTATATCTTTGTTTCTTTGGGG + Intronic
1106971946 13:35152036-35152058 GTGATATTATTTTTGCTTTATGG + Intronic
1107632276 13:42354751-42354773 CTGACATCATAGTTCCTTTCTGG - Intergenic
1107754783 13:43608686-43608708 CTGATGTCATGATTGCTTTTTGG + Intronic
1107918531 13:45178766-45178788 ATGACATCATTGTTGTTTTAAGG - Intronic
1108176407 13:47797253-47797275 CTGATGTCCATGTTGCTTTGGGG - Intergenic
1108231355 13:48345754-48345776 CTGTTATCATGTTTGTTTTGAGG + Intronic
1109073851 13:57806985-57807007 CTTATTTCATTCTTTCTTTGGGG - Intergenic
1110744952 13:79041263-79041285 ATGATAAAATTGTTGATTTGAGG - Intergenic
1111471697 13:88691964-88691986 TTGATATCATTGTCAGTTTGGGG + Intergenic
1114476633 14:22999844-22999866 ATTATATCATTAATGCTTTGGGG + Intronic
1115806513 14:37057977-37057999 CGGATATGATTATTGCTGTGTGG - Intronic
1116067459 14:40002232-40002254 CTGACATCACTGGTGTTTTGGGG + Intergenic
1116374444 14:44180865-44180887 ATGCTATCATTTTTACTTTGAGG - Intergenic
1116600790 14:46919976-46919998 CTGATGTCCTTTTTTCTTTGTGG - Intronic
1117266871 14:54098171-54098193 CTCCTAACATTGTTGCATTGGGG + Intergenic
1117320999 14:54623182-54623204 CTGATGGCCTTGCTGCTTTGTGG + Intronic
1119091190 14:71782895-71782917 CCTATATCATTGTTACTATGTGG - Intergenic
1121504021 14:94462503-94462525 CTGGTTTCATTGTTGCTGTAGGG + Intergenic
1124511497 15:30331245-30331267 CTTGTATCATTTTTGCTTTTAGG + Intergenic
1124731417 15:32199512-32199534 CTTGTATCATTTTTGCTTTTAGG - Intergenic
1126955548 15:53929397-53929419 GTGATATCATTTTTTCTTAGTGG - Intergenic
1127111740 15:55680587-55680609 CTGCTATAATTGTTGGTGTGTGG + Exonic
1131850082 15:96531689-96531711 GTTATATAATTTTTGCTTTGAGG - Intergenic
1131937377 15:97521689-97521711 CTGAAACCCTTGTTGCTTTAAGG - Intergenic
1132736422 16:1388268-1388290 CTCAGATCAGTGCTGCTTTGGGG - Intronic
1133627500 16:7584920-7584942 CTGATGTCATTGTTTCATTTAGG + Intronic
1137726849 16:50662486-50662508 CAGATGTTATTGTTGTTTTGGGG - Intergenic
1143173805 17:4945195-4945217 CTAATAAAATTGTTTCTTTGTGG + Exonic
1144228696 17:13177097-13177119 CTGATAACATAGTTGCCTTTGGG + Intergenic
1147481042 17:40762868-40762890 ATGAAATTATTGTTCCTTTGGGG + Intergenic
1149128436 17:53264552-53264574 CAGATATCAAAGTTGCTATGAGG + Intergenic
1151142977 17:72013145-72013167 CTTATATCATTCTTGATTTCTGG + Intergenic
1151150727 17:72083842-72083864 CAGGTACCATTGCTGCTTTGGGG - Intergenic
1153921789 18:9798218-9798240 CTGATATCCATGTGGCTATGTGG + Intronic
1155841713 18:30653329-30653351 GGGATATCATGGTTGCTCTGTGG - Intergenic
1157587189 18:48810679-48810701 CTGATATAATTCTTCCTTTCTGG + Intronic
1158802289 18:60926648-60926670 ATGATTTCATTCTTTCTTTGTGG - Intergenic
1159604648 18:70462421-70462443 ATGAATTCATTGTTTCTTTGAGG + Intergenic
1166192373 19:41183490-41183512 CAGAGAACATTGCTGCTTTGGGG + Intergenic
1166549576 19:43656386-43656408 CTGACATCCCTGTTACTTTGGGG + Intronic
1168471551 19:56644224-56644246 CTGATTTGTTTATTGCTTTGGGG - Intronic
925112655 2:1349528-1349550 CTGTTATCATCCTTGCTTTAAGG + Intronic
925807377 2:7664079-7664101 ATAATATCATTGTATCTTTGGGG - Intergenic
926365416 2:12128800-12128822 CTGGTATCAGGGTTGCTCTGAGG + Intergenic
927233797 2:20851327-20851349 TTGTTCTCTTTGTTGCTTTGAGG - Intergenic
932850516 2:75180018-75180040 CCAATATCATTCCTGCTTTGGGG + Intronic
935366205 2:102293533-102293555 CTGGTTTCACTGTTGATTTGGGG - Intergenic
936746738 2:115585595-115585617 ATGGTATCTTTGTTTCTTTGAGG - Intronic
937496237 2:122423134-122423156 GTGATATCATAGGGGCTTTGAGG - Intergenic
937564617 2:123269064-123269086 CTTCCAACATTGTTGCTTTGGGG + Intergenic
937951714 2:127393160-127393182 CTCCTAACATTGTTGCATTGGGG + Intergenic
939626165 2:144480010-144480032 ATGATATGATTTGTGCTTTGCGG - Intronic
939668132 2:144975948-144975970 CTGACATTATTGCTGCTTTTAGG - Intergenic
939840031 2:147175757-147175779 CAGATATCACTGATGGTTTGAGG - Intergenic
940227197 2:151412103-151412125 CCGTTATCATTTTTGCTTTAGGG + Intronic
940867866 2:158835328-158835350 GTGATACCATTGTGGGTTTGTGG + Intronic
941129982 2:161635955-161635977 GTGAAATCATTGATGCTTTATGG - Intronic
945552587 2:211238683-211238705 CTGATATCATTCTTGAGATGGGG + Intergenic
948703289 2:239774173-239774195 CAGGCATCATTGTTCCTTTGAGG - Intronic
1169497420 20:6128783-6128805 CTGCTAGCATGGTTGTTTTGAGG + Intergenic
1169919731 20:10722104-10722126 CTCTTATCAGTGTTACTTTGGGG - Intergenic
1170261214 20:14410561-14410583 ATGATTTCATTGTTTTTTTGTGG + Intronic
1170391699 20:15881757-15881779 CTATTATCATTCTTGCTTTTAGG + Intronic
1172012683 20:31855329-31855351 CTGATACAAGTGTTGCTTTGGGG + Intronic
1173280146 20:41619675-41619697 CTCAGATCATTTCTGCTTTGAGG - Intergenic
1180117759 21:45723077-45723099 CTGCTATCATTGTTTCTATCTGG + Intronic
1182254246 22:29026796-29026818 CTGTGATCATTGTTGTTTGGAGG + Intronic
1182615213 22:31583769-31583791 CTGAGGTCATTTCTGCTTTGGGG + Intronic
1182932324 22:34186979-34187001 CTAATAACATTGATGCGTTGAGG + Intergenic
1183771179 22:39927296-39927318 TTTATTTCATTGTTGATTTGTGG + Intronic
1184363107 22:44030539-44030561 CCGATTTCAGTGGTGCTTTGGGG + Intronic
1184401273 22:44276072-44276094 CTGACATCACGTTTGCTTTGTGG - Intronic
1184906985 22:47494843-47494865 CTGCTCTCCTTGTTGCTTTCTGG + Intergenic
949432865 3:3996766-3996788 CTAATTTGATTGTTGCATTGTGG - Intronic
949543950 3:5055943-5055965 CTGATGTCCTATTTGCTTTGAGG + Intergenic
949993509 3:9598932-9598954 CTGCTATCATCCTTGCTTTAAGG + Intergenic
950319216 3:12034754-12034776 CTCATAACACTGTTGCATTGGGG + Intronic
951409949 3:22351036-22351058 CTGACATCAGTGTAGCATTGTGG - Intronic
952585200 3:34884238-34884260 CTGAGATCCTTGTTGCTGTATGG + Intergenic
954188938 3:48942435-48942457 CTGATGTCATTTTAGCTTTCAGG + Intronic
954767837 3:52936567-52936589 CTGATAACTTTTTTGCTTTTTGG + Intronic
955894051 3:63680101-63680123 CTAGTATCTTTGTGGCTTTGGGG + Intergenic
956431787 3:69193648-69193670 CTGGTAACACTGTTGCTTTCTGG + Exonic
956915475 3:73866759-73866781 CTATTATCATTCTTGCTTTAAGG - Intergenic
957647759 3:82955066-82955088 CTACTGTCATAGTTGCTTTGGGG - Intergenic
959362805 3:105415514-105415536 CTGATATTAATGTGGCCTTGGGG - Intronic
959829241 3:110840556-110840578 CTGAAATCATTGTCAATTTGGGG + Intergenic
960353336 3:116620268-116620290 CTGATGTCCATGTTGCATTGTGG - Intronic
960889482 3:122432507-122432529 CTACTTACATTGTTGCTTTGTGG - Intronic
961443562 3:126967185-126967207 CTGGTATCATTACTGCTTGGAGG - Intergenic
966022151 3:175227232-175227254 CTGACATCACTGTTGCTCTGTGG + Intronic
966129224 3:176617688-176617710 CTGGTATTATTGTTACTTTTGGG + Intergenic
967312787 3:188121875-188121897 CTGATATCCTGTATGCTTTGGGG - Intergenic
967778225 3:193406703-193406725 CTCATATCATTTTTGCCTTGCGG - Intronic
967959123 3:194905874-194905896 CTTACCTCATTGTTGTTTTGTGG - Intergenic
968061975 3:195732691-195732713 CTGAAATCATTTCTGGTTTGGGG - Intronic
968794216 4:2691564-2691586 CTGATCACATTATTGCTTTTGGG - Intronic
971438024 4:26648869-26648891 CTCGTAACATTGTTTCTTTGAGG + Intronic
971816710 4:31499951-31499973 CTACTATTATTGTTGTTTTGAGG + Intergenic
972794970 4:42406443-42406465 CAGATATCACTGTTGATTAGGGG + Intergenic
974516900 4:62927437-62927459 CTCATATCATTATCGCTTTTAGG - Intergenic
975504535 4:75123308-75123330 CTTGTCTCAGTGTTGCTTTGGGG + Intergenic
976270383 4:83224618-83224640 CTCTTGACATTGTTGCTTTGGGG - Intergenic
976429688 4:84947932-84947954 AAGATATCAGAGTTGCTTTGAGG - Intronic
976487135 4:85621101-85621123 CTGATTTCATTCTTTTTTTGTGG + Intronic
976515710 4:85963503-85963525 CTGATGTAATTATTGCTTTAAGG + Intronic
978373066 4:108048615-108048637 TTGATGTCAGTGTTCCTTTGGGG + Exonic
980842259 4:138278175-138278197 CTCACCTCATTGTTGCATTGGGG - Intergenic
981523330 4:145687558-145687580 TTGACCTCATTGTTGCTTAGGGG + Intronic
983732060 4:171008001-171008023 CTAATACCTTTGTTACTTTGGGG - Intergenic
983772779 4:171571423-171571445 CTGGTAACATTGTAGGTTTGGGG + Intergenic
984848214 4:184125979-184126001 GTGATATCTTATTTGCTTTGGGG - Intronic
986374565 5:7116827-7116849 ATGATCTCATTCTTCCTTTGTGG + Intergenic
986837795 5:11660419-11660441 ATGATATCATTTTGACTTTGAGG + Intronic
987462379 5:18227967-18227989 CTGTTATGATTATTGCTATGTGG + Intergenic
988377963 5:30462529-30462551 CTTATATTTTTGTTTCTTTGTGG - Intergenic
989129382 5:38091173-38091195 CTGGCATCAATGTTGCTGTGGGG + Intergenic
990975158 5:61553624-61553646 ATGATATCATTGTTTTTTTATGG + Intergenic
990992376 5:61698784-61698806 TTCATACCAATGTTGCTTTGAGG + Intronic
991092622 5:62707707-62707729 CTGATATGTTTGTTTCCTTGGGG - Intergenic
992041243 5:72835625-72835647 CTGTTAATATTGTTGCATTGAGG + Intronic
992480170 5:77143250-77143272 CTGATATCATTATTGCTCTGTGG + Intergenic
995570847 5:113479800-113479822 ATGGTTTCATTGTAGCTTTGAGG + Intronic
996273282 5:121634882-121634904 ATGATTTCATAGTTTCTTTGTGG - Intergenic
999500507 5:152142343-152142365 ATGATGTCATTTTTCCTTTGAGG - Intergenic
999984197 5:156987116-156987138 CTGAGAAGATTGTTGATTTGGGG - Intergenic
1000266611 5:159644038-159644060 CTGTTATTATTATTTCTTTGTGG - Intergenic
1001007010 5:168061070-168061092 CTGAGGTCATTCTTGTTTTGAGG - Intronic
1003025102 6:2547834-2547856 CTGTTATCATCCTTGCTTTAAGG - Intergenic
1004835176 6:19522865-19522887 CTGATATTATTGTGGATTTCAGG - Intergenic
1005137032 6:22580981-22581003 CTGAATTCATTGTAGCTGTGTGG + Intergenic
1006326780 6:33360232-33360254 CTGATCTCACTGGTGCTTTCTGG - Intergenic
1007710267 6:43818451-43818473 CAGATATCTCTGTTTCTTTGAGG + Intergenic
1009407666 6:63330333-63330355 CTGATCTCATTTTTCCTTTTGGG + Intergenic
1010334898 6:74669077-74669099 CTGGTATCATTGTTAAGTTGTGG - Intergenic
1012692031 6:102326512-102326534 CTGATAACTATGTGGCTTTGTGG + Intergenic
1014784399 6:125600986-125601008 CTGTTATTATTTTTGATTTGGGG + Intergenic
1017507382 6:155080999-155081021 CTGAAATCATTGTTTCCTGGAGG + Intronic
1017975686 6:159355288-159355310 CTATTATCATCTTTGCTTTGAGG - Intergenic
1018300792 6:162400609-162400631 CTGAAATCATTGTGGATTTTAGG + Intronic
1019226074 6:170510604-170510626 CTGTTATCCTGGTTGCTGTGGGG - Intergenic
1020248877 7:6451235-6451257 TTGTTGTCGTTGTTGCTTTGTGG - Intronic
1023378591 7:39583727-39583749 GTGACATCATTGTTTCTGTGGGG + Intronic
1024559979 7:50635575-50635597 TTGATTTCATTGATCCTTTGTGG - Intronic
1027658974 7:80966016-80966038 CTGATTTTATTGTTCTTTTGAGG + Intergenic
1028253906 7:88568408-88568430 TTTATATCATTGGTGCTTGGGGG + Intergenic
1029002697 7:97171772-97171794 CATATATCATTATTACTTTGGGG + Intronic
1029953036 7:104607173-104607195 CTATTATCATCCTTGCTTTGAGG + Intronic
1030391098 7:108930117-108930139 CTGATATTCTTGTATCTTTGTGG + Intergenic
1031031375 7:116739261-116739283 TTGATGTCATTTTTGCTTTCAGG - Intronic
1032660164 7:133974074-133974096 CTCTTAACATTGTTGCATTGGGG + Intronic
1033580957 7:142734989-142735011 TTGATAGCGTAGTTGCTTTGTGG - Intergenic
1036054077 8:5230739-5230761 CAGGTGTCACTGTTGCTTTGAGG + Intergenic
1036075809 8:5498429-5498451 CTGAAATACTTATTGCTTTGGGG - Intergenic
1036577361 8:10040552-10040574 CTGATATCAATCTTGCTTTCAGG + Intergenic
1039241772 8:35564921-35564943 ATGATTTCATTGTTTTTTTGTGG + Intronic
1040500664 8:48002174-48002196 CTCTTAACATTGTTGCATTGGGG + Intergenic
1041829058 8:62132288-62132310 TTGATAACATTGGTTCTTTGAGG - Intergenic
1042837526 8:73091946-73091968 CTAATATCTGTGTGGCTTTGGGG + Intronic
1044926739 8:97215603-97215625 CTGTTATAATTGTTCCTTTGAGG - Intergenic
1045095867 8:98797835-98797857 CTTATATCATTGTTGTTCTGTGG - Intronic
1045756583 8:105550318-105550340 CTGATATGATAGTGGGTTTGAGG + Intronic
1046843067 8:118882972-118882994 CTGATTTCATTTCTGCTTTAAGG + Intergenic
1047050479 8:121106113-121106135 CTGGTATAATTGTGGCTATGGGG - Intergenic
1047535539 8:125716256-125716278 TTGATAACATTTTTGCTTTCTGG + Intergenic
1050463703 9:5898467-5898489 CTCTTACCATTGTTGCATTGGGG + Intronic
1051924812 9:22310909-22310931 CTGTTATCATCTTTGCTTTAAGG + Intergenic
1052444202 9:28538805-28538827 CTCCTAACATTGTTGCATTGGGG + Intronic
1052805427 9:33009164-33009186 TTCATATCATTGGTGGTTTGTGG + Intronic
1054756642 9:68965506-68965528 TTTATATCATTGTTCATTTGTGG - Intronic
1055265763 9:74494395-74494417 CTGATAACAATGTTACTTTTAGG - Intergenic
1055762660 9:79625501-79625523 CTGATATCATTGTTGAGTATAGG + Intronic
1057510383 9:95674146-95674168 CTCTCAACATTGTTGCTTTGGGG + Intergenic
1058600484 9:106664380-106664402 GTGTAATCATTGTTGCTGTGTGG + Intergenic
1060066034 9:120501841-120501863 ATGAAATGATTGTTGTTTTGGGG + Intronic
1060706509 9:125806613-125806635 CTGTTAATACTGTTGCTTTGTGG + Intronic
1062278526 9:135741808-135741830 CTGAAAACATGGTTGTTTTGAGG + Intronic
1187613179 X:20964937-20964959 CTGTTATTATTGTTGTTTTAAGG + Intergenic
1188945712 X:36298661-36298683 CTGGTATCATTATTTCTATGAGG - Intronic
1189387229 X:40547070-40547092 ATGATGTCATTGTTGCTTTAGGG - Intergenic
1189556352 X:42149462-42149484 CTGATATCATTGTTTCAGTGGGG - Intergenic
1189610312 X:42726241-42726263 CTCACAACACTGTTGCTTTGGGG - Intergenic
1190570693 X:51778755-51778777 CTGATATATTGGTTGCCTTGGGG - Intergenic
1192147662 X:68692915-68692937 TTGATTTCATTGTTGAATTGAGG - Intronic
1194164253 X:90495407-90495429 CTCTCACCATTGTTGCTTTGAGG + Intergenic
1195484954 X:105393557-105393579 CTGTTATCATCCTTGCTTTAAGG + Intronic
1196149314 X:112354889-112354911 CTGTTGTCATTGTTGTTTTAGGG - Intergenic
1197869738 X:131053675-131053697 GTGAAATCATGGGTGCTTTGGGG - Intergenic
1201271913 Y:12263805-12263827 CTGATCTCATTTTTCCTTTTTGG + Intergenic
1201706140 Y:16939230-16939252 CTGACATAATAGATGCTTTGAGG + Intergenic
1202257857 Y:22939908-22939930 CTGATCTCATTTTTCCTTTTGGG - Intergenic