ID: 1064607518

View in Genome Browser
Species Human (GRCh38)
Location 10:17059340-17059362
Sequence TTCTGTGGCTCAAATTTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 302}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064607518_1064607523 6 Left 1064607518 10:17059340-17059362 CCCATAAAATTTGAGCCACAGAA 0: 1
1: 0
2: 5
3: 24
4: 302
Right 1064607523 10:17059369-17059391 TAAGCTGATCCTCTGGAGAGAGG No data
1064607518_1064607526 22 Left 1064607518 10:17059340-17059362 CCCATAAAATTTGAGCCACAGAA 0: 1
1: 0
2: 5
3: 24
4: 302
Right 1064607526 10:17059385-17059407 AGAGAGGAATGCATCTCATAGGG No data
1064607518_1064607522 -1 Left 1064607518 10:17059340-17059362 CCCATAAAATTTGAGCCACAGAA 0: 1
1: 0
2: 5
3: 24
4: 302
Right 1064607522 10:17059362-17059384 AATAGGATAAGCTGATCCTCTGG No data
1064607518_1064607525 21 Left 1064607518 10:17059340-17059362 CCCATAAAATTTGAGCCACAGAA 0: 1
1: 0
2: 5
3: 24
4: 302
Right 1064607525 10:17059384-17059406 GAGAGAGGAATGCATCTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064607518 Original CRISPR TTCTGTGGCTCAAATTTTAT GGG (reversed) Intronic
900991983 1:6102321-6102343 TTCTGTGTCTGAAAGTTTACAGG - Exonic
903605297 1:24571127-24571149 ATATGTGGCTCACATTATATTGG - Intronic
904322162 1:29705057-29705079 CTCTGTGTCTAATATTTTATAGG + Intergenic
906359434 1:45140227-45140249 TTCTGTGAATAAAGTTTTATTGG + Intronic
908767185 1:67564739-67564761 TTTTATGGCTCCCATTTTATTGG + Intergenic
910522885 1:88143143-88143165 TTCTGTGTCTCAAATTTTGTAGG + Intergenic
911451711 1:98070229-98070251 TTCTGGGATACAAATTTTATAGG + Intergenic
911800260 1:102128353-102128375 TTCTTGGGCTCATATTCTATAGG + Intergenic
915767654 1:158381671-158381693 TTCTGAAGATCAAATTTTAATGG - Intergenic
916628535 1:166586587-166586609 TTCTGTAAATCAAGTTTTATCGG + Intergenic
918754494 1:188320813-188320835 TTCTTTGGCACCAATTTTAGGGG + Intergenic
919714109 1:200757063-200757085 TTCTGTGGCTTACTTTTAATTGG + Intronic
920656846 1:207883071-207883093 TTCTGTGGCTCCTCTTCTATTGG + Intergenic
921126048 1:212179164-212179186 TTCTGTGATTCTAATTTAATGGG - Intergenic
921576959 1:216846517-216846539 TTTTGTGAATAAAATTTTATCGG - Intronic
922899955 1:229129168-229129190 TTTTATGGCTCAAATTTCCTGGG - Intergenic
923137396 1:231130536-231130558 TTGTGTGGCTCAGATTGTGTAGG - Intergenic
923240245 1:232077506-232077528 TTCTGTAACTTAAAATTTATAGG - Intergenic
923544866 1:234916880-234916902 GTATGTGTGTCAAATTTTATGGG - Intergenic
924002188 1:239566711-239566733 TTCTTTGACTCAACTTTCATGGG + Intronic
924947259 1:248854992-248855014 TTCTGTGCCTCAAATTTCTCAGG + Intronic
1063561893 10:7136062-7136084 AACTCTGGCTCAAATTTTAAAGG + Intergenic
1064607518 10:17059340-17059362 TTCTGTGGCTCAAATTTTATGGG - Intronic
1065109392 10:22424987-22425009 TTCTGTGGGTCAAGTGTTCTTGG + Intronic
1065315600 10:24460662-24460684 GTCTGTGGAGCAAATTTTAAAGG - Intronic
1066565771 10:36720225-36720247 TCCTGTGGCTAACACTTTATAGG - Intergenic
1067268736 10:44771232-44771254 TTCAGTGGTTCAATTTTTAGTGG + Intergenic
1067760663 10:49043398-49043420 CTATGTGGCTCAAATAATATGGG + Intronic
1068127671 10:52861703-52861725 TTTTGTTCCTCAATTTTTATAGG - Intergenic
1068581335 10:58743358-58743380 TTCTATAGCTCAAGTTTCATTGG - Intronic
1068941307 10:62683885-62683907 TTTTGTGAATCAAGTTTTATTGG - Intergenic
1069644294 10:69981339-69981361 GTCTGTGTCCCAAATTTTCTTGG + Intergenic
1071708794 10:88028346-88028368 TCCTTCTGCTCAAATTTTATTGG + Intergenic
1071844069 10:89503761-89503783 CTCTGTGGCCCAAATTGTATGGG - Intronic
1071847223 10:89533763-89533785 TTTTGTGGCACAATTTTTAAAGG - Intronic
1072861340 10:99008225-99008247 TGCTGGGGCACAGATTTTATTGG - Intronic
1073454327 10:103627418-103627440 TAGTGTGGCTCACAGTTTATTGG - Intronic
1073865375 10:107797484-107797506 TTATGTGGCTCAAATTATAAAGG + Intergenic
1074315403 10:112356899-112356921 TTCTGTGGTTCTTATTTTACCGG - Intergenic
1075816134 10:125265914-125265936 TTCTGAAGTTCAAATTTTACTGG - Intergenic
1077563650 11:3282223-3282245 TTATGTGGCTTACAGTTTATGGG + Intergenic
1077569540 11:3328040-3328062 TTATGTGGCTTACAGTTTATGGG + Intergenic
1077867126 11:6231933-6231955 TTGTGATGCTCACATTTTATGGG - Intronic
1078866338 11:15301588-15301610 TTCTGTAAATAAAATTTTATTGG - Intergenic
1081419383 11:42855076-42855098 TTCTGTAAATAAAATTTTATTGG + Intergenic
1081783023 11:45726652-45726674 TTCTGTTGCTCAAATTAATTAGG + Intergenic
1082251162 11:49981984-49982006 TTCTGTGGCCCCAATGTCATAGG - Exonic
1082756802 11:57084645-57084667 TCCTGTGGCTATAATTCTATGGG + Intergenic
1085829674 11:79885995-79886017 TTCTGTGGGTCAGCATTTATTGG - Intergenic
1086392687 11:86381633-86381655 TTCTGTCTCTCCAATTTTAGGGG + Intronic
1087184225 11:95169883-95169905 AGCTCTGGTTCAAATTTTATAGG + Exonic
1088515121 11:110624347-110624369 TTTTGTTTCTTAAATTTTATGGG + Intronic
1089880147 11:121765894-121765916 TGCTGTGGCTGGAATTTTATGGG + Intergenic
1091777308 12:3192824-3192846 TTGTGTGGCTGAAATTCTAAGGG - Intronic
1093652417 12:21660652-21660674 TACTGTGCCTCAAGTTTAATAGG - Intronic
1094010510 12:25804063-25804085 TTCTGTGCCTGGAATCTTATGGG - Intergenic
1094689974 12:32759008-32759030 ATCCGTGGCTAAAATTTTATGGG + Intergenic
1095822417 12:46492855-46492877 TTCTGGGACTCACACTTTATGGG - Intergenic
1097594369 12:61610212-61610234 TTGGGTGCCTCAAGTTTTATAGG - Intergenic
1097780241 12:63694385-63694407 TACTGTTGTTCAAATTTTCTGGG + Intergenic
1098125259 12:67285222-67285244 TTCTGTTGTTCCAAATTTATGGG + Intronic
1098726043 12:73968773-73968795 TTATCTTGCTCCAATTTTATTGG - Intergenic
1100621988 12:96285534-96285556 TGTTCTGACTCAAATTTTATTGG + Intronic
1100894475 12:99164638-99164660 TTCTGAGGGTCTAATTTTACTGG - Intronic
1101356541 12:103983364-103983386 TTCTGTGTCTGGAATCTTATGGG - Exonic
1104050262 12:125189907-125189929 TTCTGTGTCTCAATTTGAATGGG + Intronic
1105835152 13:24203644-24203666 TTCTGGGGCTTAAATTTCACGGG + Intronic
1108499235 13:51054514-51054536 TTTTGTAGCTAAATTTTTATTGG + Intergenic
1108787989 13:53929858-53929880 TTCTGTGCCTGAAATTTAATAGG + Intergenic
1109347221 13:61128676-61128698 TTATGTAGTTCAAATTTTCTTGG - Intergenic
1109446942 13:62452406-62452428 TTCATTGCCTCAAATTATATAGG + Intergenic
1109658861 13:65431969-65431991 TTCTGTGCATGAAATTTTTTGGG + Intergenic
1109674725 13:65660489-65660511 TTCTGTTGCTAAAATATTCTAGG - Intergenic
1109736430 13:66490555-66490577 TTCTGTGGCTTTTATTTTACTGG + Intronic
1110286879 13:73760086-73760108 TTCTGTGTCACAAATTTTTGTGG - Intronic
1111280776 13:86021173-86021195 TACTGTGTTTTAAATTTTATGGG + Intergenic
1111614623 13:90646742-90646764 TTTTCTGGCTTAAACTTTATAGG + Intergenic
1111617157 13:90674526-90674548 TTCTGGAACTAAAATTTTATAGG + Intergenic
1111905348 13:94249326-94249348 TTTTGTGGCTCAAGATTTATTGG - Intronic
1113077068 13:106477455-106477477 TTCTGTGAGTAAATTTTTATTGG + Intergenic
1113571077 13:111358486-111358508 ATCTGTGGCTCAGTTTTGATTGG - Intergenic
1116199481 14:41772385-41772407 TTTTGTGGATCATATTTTACGGG - Intronic
1116351865 14:43872705-43872727 CTCTGTGGCTCAAAAGTTAAAGG - Intergenic
1116803615 14:49468864-49468886 TTTTGTGGCTCACATTTAAATGG + Intergenic
1116810974 14:49540067-49540089 GTCTGTCTCTCCAATTTTATGGG - Intergenic
1119827298 14:77668081-77668103 TTTGTTGGCTCTAATTTTATTGG - Intergenic
1121046038 14:90788435-90788457 TTCTGTGGCTCTAATTCTTGTGG - Intronic
1123203260 14:106687611-106687633 TTCTGTGACTAACATTTTATGGG - Intergenic
1202943253 14_KI270726v1_random:3116-3138 TTCTTTGGGTCAAATTTTGAAGG - Intergenic
1124217669 15:27822009-27822031 TTCTGTGACTGAAGTTTTATTGG - Intronic
1124805870 15:32882155-32882177 TTCTGTGGCTCATCTTCTAAAGG - Intronic
1124807926 15:32905155-32905177 TTCTGTGTCTCACATTATTTGGG + Intronic
1125143038 15:36432307-36432329 TTCTGTGGCTAAGATTTTACTGG - Intergenic
1125982556 15:44016235-44016257 TTCTCTTGGTCAAATATTATGGG - Intronic
1125985952 15:44052251-44052273 TTTTGTTGCTCAAATTTTTCTGG + Intronic
1126125015 15:45287525-45287547 TTCTGTAAATAAAATTTTATTGG - Intergenic
1126359709 15:47833880-47833902 TTCTGTGCCTGAGAGTTTATGGG + Intergenic
1126450526 15:48803743-48803765 TTGTGTGGTTAAAATTTTAGAGG - Intronic
1127145282 15:56016981-56017003 ATTAGTAGCTCAAATTTTATTGG + Intergenic
1127325851 15:57894677-57894699 TTCTTTGGCTCTGATTTTAGTGG - Intergenic
1131038050 15:89238372-89238394 TTCTGTACCTAAAAATTTATGGG - Intergenic
1132211186 15:100023504-100023526 TTCTGTGAATAAAATTTTCTTGG - Intronic
1133262813 16:4562795-4562817 TTATATGGCTCGAATTTTACAGG + Intronic
1134818224 16:17223766-17223788 TTTTGTAAGTCAAATTTTATTGG - Intronic
1138154789 16:54693152-54693174 TGCTTTTGCTCATATTTTATTGG - Intergenic
1140838404 16:78816760-78816782 TTTTGTGGCTCAGTTTTTTTTGG + Intronic
1141095573 16:81160555-81160577 TTCAGTGGCTTATTTTTTATTGG - Intergenic
1141247437 16:82322128-82322150 TTCTGTGGCACTATTTTTAATGG + Intergenic
1143934606 17:10469881-10469903 TTCTGTTGGACCAATTTTATAGG - Intergenic
1147231732 17:39024308-39024330 TACAGTGGCACAAATGTTATAGG + Intergenic
1149106186 17:52969305-52969327 TTTTGAGGCTCAAATTTTCCTGG + Intergenic
1150051301 17:61966374-61966396 TTTTGTAGATAAAATTTTATTGG - Intronic
1150531271 17:65984902-65984924 TTCTGTGGCACACATTCTTTTGG - Intronic
1150665751 17:67135657-67135679 TTGTGGGGCTTACATTTTATTGG - Intronic
1151010668 17:70491565-70491587 TACAGTGGCTAAATTTTTATAGG + Intergenic
1151125637 17:71841814-71841836 TTCTGTTGCTCAAATCTTTTAGG - Intergenic
1153148673 18:2063792-2063814 TTTTGTTGCTCAAGATTTATGGG + Intergenic
1153739165 18:8105059-8105081 ATCTGTGGCTAAAATTGTTTAGG + Intronic
1157299571 18:46469720-46469742 TTCTGAGGCTGAAGTTTTCTTGG + Intergenic
1158120658 18:54044764-54044786 TTCTGTGGTTACAATTTTTTAGG - Intergenic
1158370385 18:56795481-56795503 TTCTGTAGTTCCAAATTTATTGG - Intronic
1158630080 18:59104919-59104941 TTCTTTGGCTATAATATTATGGG - Intergenic
1159753389 18:72331013-72331035 TTTTATTGCTCAATTTTTATTGG - Intergenic
1161788713 19:6345219-6345241 TTATGTGGATAAATTTTTATTGG + Intergenic
1163055807 19:14716723-14716745 TTCTGTGACTAAAAGTTTTTGGG + Intronic
1165583031 19:36886050-36886072 ATTTGTTGCTCAAATTTTCTTGG - Intronic
925208167 2:2025078-2025100 TTCTGTGTTTTTAATTTTATAGG + Intronic
926425535 2:12735826-12735848 TTCAGAGGCTGAAATTTTAGTGG - Intronic
926748951 2:16183169-16183191 TTCCTTTGCCCAAATTTTATTGG + Intergenic
927067305 2:19486291-19486313 TTCAGTCGCTCAAATTTTTGGGG + Intergenic
927910628 2:26896090-26896112 TTCTATGGATCAACTTTTTTAGG + Intronic
929250207 2:39745703-39745725 TTCTGGGTCTCCATTTTTATTGG + Intronic
933587533 2:84195546-84195568 TTCTGTGCCTTAAAGTTTATGGG + Intergenic
933591742 2:84240634-84240656 TTCTGTGCCTCTAATTCTAAAGG - Intergenic
937385426 2:121427192-121427214 TTATATAGCTCAAATTTTATGGG - Intronic
939038645 2:137162561-137162583 TTCTGAGGGTCAGATTTTATAGG + Intronic
939341448 2:140900497-140900519 CTCTGGGACTCAAATTTTAATGG + Intronic
939413486 2:141862392-141862414 TTCAGTGGCTGATATTTTATTGG - Intronic
940128392 2:150353870-150353892 TTCTGTGGCTCAAACTTGTTAGG - Intergenic
941182410 2:162275527-162275549 TTCTCTGGCATTAATTTTATTGG + Intronic
941338249 2:164271376-164271398 TTCTTTTGCTTAATTTTTATTGG - Intergenic
942029295 2:171942771-171942793 TTCTGTGGACCAAATTTTATGGG + Intronic
942713739 2:178867299-178867321 TTGTGTGGTTCACATTTTGTTGG - Intronic
942944121 2:181655015-181655037 TTCTGTGCCCCCAATTTTAGAGG + Intronic
943073043 2:183164610-183164632 TTATGTGGCTTAGATTTTAGTGG - Intergenic
944021449 2:195110032-195110054 TTCTGTGGGTTAAATTTGCTTGG - Intergenic
944672879 2:202010308-202010330 TTCTCTGGGTCAGATTTTATGGG - Intergenic
945461744 2:210117408-210117430 TTCTTTGGATTAAATTTTCTTGG - Intronic
946788124 2:223269757-223269779 TTCTGTCCCTCAAATTTTGCTGG + Intergenic
1170174032 20:13447524-13447546 TTCACTAGCACAAATTTTATTGG + Intronic
1170409708 20:16075522-16075544 TTCTCTGGCTCCAATTTTCAGGG + Intergenic
1171327966 20:24312431-24312453 TTAAGTGGCTTCAATTTTATGGG - Intergenic
1172632244 20:36386251-36386273 TTCTGGGGCTCAAATCATAGGGG + Intronic
1173411586 20:42815870-42815892 TTGTGTGGCTCAAAATGTCTGGG - Intronic
1173970578 20:47149164-47149186 TTGAATGGCTGAAATTTTATAGG + Intronic
1174956340 20:55102923-55102945 TTCTGTGCTTCCAATTTCATTGG - Intergenic
1175385687 20:58593603-58593625 TTCTGTAGCTCAAATGGTCTTGG + Intergenic
1175459080 20:59137480-59137502 CTTGGTGGCTCAAACTTTATGGG + Intergenic
1178007587 21:28240182-28240204 TTCTCTGCCTCAAATCTTTTAGG + Intergenic
1179564694 21:42239972-42239994 TTCTGGGGCTCTAATTTGAGTGG - Intronic
1182182725 22:28367844-28367866 TTCAGTGGCTCAATTTTGGTAGG - Intronic
1183042021 22:35188722-35188744 TTCTGTGACCCACATTTTCTAGG - Intergenic
1185387104 22:50538784-50538806 TTCTGTAAATAAAATTTTATTGG + Intergenic
949529304 3:4938569-4938591 TTCTGTAAATCAAGTTTTATTGG - Intergenic
949652982 3:6182424-6182446 GTCTTTGGCCCAATTTTTATGGG - Intergenic
951331476 3:21374283-21374305 TTCTGTGTCTCATATATGATTGG - Intergenic
951627475 3:24681683-24681705 TACTGTGACCCAAATTATATTGG + Intergenic
952589668 3:34935297-34935319 GTCTGTGGATCTGATTTTATTGG - Intergenic
953139517 3:40214396-40214418 TTCTGTAGCTCCAATTAGATGGG - Intronic
953728113 3:45418582-45418604 TTCTGTAAATCAAGTTTTATTGG + Intronic
954487860 3:50871500-50871522 CTCTGTGGGTTAAATTTTCTTGG + Intronic
955119582 3:56043355-56043377 TTTTATGGCACTAATTTTATTGG + Intronic
955934955 3:64093868-64093890 TTCTTTTATTCAAATTTTATTGG + Exonic
956868882 3:73396852-73396874 TTCAGTGCCTGAAAATTTATGGG + Intronic
957242586 3:77677626-77677648 TTCTGTCTCTCAAATCATATTGG + Intergenic
957458522 3:80486442-80486464 TTCAGTTGTTCAAATTCTATTGG - Intergenic
957588107 3:82158680-82158702 TTCTGTGTCTCTAATTTTATGGG - Intergenic
957818642 3:85338815-85338837 TACTGTAACTAAAATTTTATTGG - Intronic
958606123 3:96360735-96360757 TTCTGTGGCTAATACTGTATTGG + Intergenic
958690475 3:97459537-97459559 TACTGAGGCTCAAATTTCCTAGG + Intronic
959008902 3:101051234-101051256 TTCTGTAAATAAAATTTTATTGG - Intergenic
959108210 3:102090668-102090690 ATCAGTGGCTCAAATGTCATTGG + Intergenic
959353988 3:105302420-105302442 TTCTGGGACCCCAATTTTATGGG - Intergenic
959606813 3:108250104-108250126 GACTTTGGCTCAAATTTAATAGG + Intergenic
959646992 3:108714777-108714799 TTCTGGGCCCCAAATTATATAGG - Intergenic
960828890 3:121822935-121822957 TTCTCTGGGTCAAATTATCTGGG - Intronic
961758874 3:129150195-129150217 TTCTATGTCTGAAATTTAATTGG - Intronic
963482448 3:145893245-145893267 ATTTGTGTCTCAAATTGTATAGG - Intergenic
963793815 3:149611326-149611348 TTCTGTGAATAAAGTTTTATTGG + Intronic
968900203 4:3427349-3427371 TTCTGTGGCCCAAATGTGACTGG - Intronic
970248384 4:14088519-14088541 TTGTGAAGCTCAAATTTTAAAGG + Intergenic
970772625 4:19633579-19633601 TTCTGTGGGTCAAATGTTCTGGG + Intergenic
971109446 4:23567021-23567043 GTCTGTGTCTCAGATTTTTTTGG + Intergenic
971416197 4:26432734-26432756 TACTGTGGCTCCTGTTTTATGGG - Exonic
971927339 4:33029881-33029903 TGCTGTGGCACACATTCTATCGG - Intergenic
972621034 4:40748869-40748891 CACTTTGGCTCACATTTTATTGG - Intergenic
972909401 4:43796554-43796576 TTTTGTGACTAAAATTTGATGGG - Intergenic
973870561 4:55161750-55161772 TTCTGAGGCTCCCATATTATTGG + Intergenic
974378943 4:61112921-61112943 CTCTTTTGCTCAAATTTCATTGG - Intergenic
974492998 4:62590761-62590783 TTCTCTTGCTCAGATTTTTTTGG + Intergenic
975828649 4:78346170-78346192 TTCTGTGGCTTACTTTTAATAGG + Intronic
975872301 4:78793913-78793935 ATATGTGGCTCACATTATATTGG + Intronic
975889053 4:79002812-79002834 TTCTGTGACTTCAATTATATAGG + Intergenic
976234747 4:82884431-82884453 CTTTGTGGCTCAACTTTTCTAGG - Intronic
977327533 4:95594945-95594967 ACCTTTGGCTTAAATTTTATTGG - Intergenic
977375198 4:96194305-96194327 TTCTGTAGCCCAAATTCTTTAGG + Intergenic
978819131 4:112945246-112945268 TACTTTGGCTCACATTTCATTGG + Intronic
978919406 4:114164735-114164757 TTCTGTGATTCAAATATAATAGG + Intergenic
980247224 4:130262927-130262949 TTCTGTGCCTAAATTTTTATAGG + Intergenic
980534980 4:134107052-134107074 TTTTGTGACTTAAATTTTTTAGG + Intergenic
980822670 4:138037573-138037595 TGCTGGAGCTCAAATTCTATAGG + Intergenic
981134876 4:141199044-141199066 ATCTGTTGCTCATTTTTTATTGG - Intronic
982547373 4:156751155-156751177 TTCTCTTCCTCAAATTTTATGGG - Intergenic
983444937 4:167838073-167838095 TTCTGTGTTTCTAAATTTATAGG - Intergenic
984243735 4:177249440-177249462 TTCTTTGGCTCAAGGTTTCTCGG - Intergenic
984483123 4:180331357-180331379 TTTTTTGGCTCAAATTGTGTTGG + Intergenic
984956264 4:185049039-185049061 TTCTGTACCTAAAAATTTATGGG - Intergenic
985385449 4:189441989-189442011 TTTTGTTTCTCAAATTCTATTGG - Intergenic
987654279 5:20785260-20785282 TTCTGTGACCCAAATTTTATTGG + Intergenic
988741356 5:34076543-34076565 TTCTGTGACCCAAATTTTATTGG - Intronic
988917256 5:35906961-35906983 TTCTGAGACTCAACTTATATTGG + Intronic
988989204 5:36652836-36652858 TTCTGTAGTTCAATTTTTAGAGG - Intronic
989143610 5:38226529-38226551 TTTTGTGGCTCAGATGCTATTGG - Intergenic
989455208 5:41636299-41636321 CTTTGTTGCTCAAATTTAATGGG - Intergenic
989529698 5:42493644-42493666 TTCTTTTGCTCTAAATTTATAGG - Intronic
993204986 5:84867503-84867525 TACTTTTGCTCACATTTTATTGG - Intergenic
993658660 5:90603172-90603194 TACTGTGGTTCAAATTTTGGGGG + Intronic
995169828 5:109094698-109094720 TTCTGTGAATAAAGTTTTATTGG - Intronic
997773714 5:136578901-136578923 TAAAGTTGCTCAAATTTTATGGG - Intergenic
997858664 5:137396167-137396189 TTCTGTTCCTCAAATTTCCTGGG + Intronic
998240813 5:140442759-140442781 TTCTGTGCCACAGAGTTTATGGG - Intronic
998423641 5:142009477-142009499 TTCTGAGGCTTAAATTATAATGG - Intronic
999034519 5:148332652-148332674 TTCAGTAGCTGTAATTTTATTGG + Intronic
999100754 5:149024002-149024024 TTCTGTGGCTAATACTATATAGG + Intronic
999377746 5:151098475-151098497 TTCTGTGGCCAAAGTTTAATCGG - Intergenic
999463541 5:151778404-151778426 GTCTTTTGCTCATATTTTATGGG + Intronic
1003433785 6:6066915-6066937 TTCTGTGCCTATAAATTTATGGG - Intergenic
1003879111 6:10464365-10464387 TTCAGTGGCACAAAGGTTATAGG - Intergenic
1003995029 6:11531631-11531653 TTCTGAGGCTCAAAACTTACAGG - Intergenic
1005129850 6:22494072-22494094 TTTTGTGGCTAAAATTTCCTTGG - Intergenic
1005259624 6:24044102-24044124 TTCTTTCCCTCAACTTTTATTGG + Intergenic
1005718626 6:28578661-28578683 TTCTGGGGCTCATATTTTCCTGG - Intronic
1006733967 6:36258791-36258813 TTCTGTGTAGCAAGTTTTATTGG - Intronic
1006881403 6:37343132-37343154 TCCTTTGGCTCACATTTTACTGG - Intergenic
1010333462 6:74652466-74652488 TTCTGAGTCTCACATTTTAGTGG + Intergenic
1011008827 6:82680778-82680800 TTCTGTGCATCAAATATGATAGG + Intergenic
1012522422 6:100136901-100136923 TTCTGTCGCTTATACTTTATTGG - Intergenic
1012953408 6:105542729-105542751 TTCTGTCTCTTAAATTTTACAGG - Intergenic
1013190207 6:107796463-107796485 GTCTTTTGCCCAAATTTTATGGG + Intronic
1013519403 6:110918700-110918722 TTCTGTGCCTATAAATTTATGGG + Intergenic
1013576130 6:111484226-111484248 TTCTTTGGCCAAAATTTTCTCGG - Intergenic
1013781041 6:113728927-113728949 TTCTGTAAATAAAATTTTATGGG + Intergenic
1014020657 6:116585021-116585043 TTCTATTACTCAAATTTTAAAGG - Intronic
1014192486 6:118513644-118513666 TTCTGTGGGTGAAGTATTATAGG - Intronic
1014447777 6:121548280-121548302 TTGTGTGGGTCAGATTTTAAGGG - Intergenic
1015170160 6:130243261-130243283 TTCTTAGGCTCAAATTTTTAAGG - Intronic
1015460908 6:133489414-133489436 TTTTTTGGGTTAAATTTTATTGG - Intronic
1015996373 6:138999016-138999038 ATTTGTGGCTGAAATTTTAATGG - Intergenic
1016432706 6:144004346-144004368 TTCTGTTTATAAAATTTTATTGG - Intronic
1016594350 6:145782618-145782640 CTCTTTGGGTTAAATTTTATTGG - Intergenic
1016630922 6:146230081-146230103 CTCTGTAGATCAAATATTATTGG + Intronic
1017361437 6:153577015-153577037 TTTTTTGGTTCATATTTTATAGG - Intergenic
1017766152 6:157608920-157608942 TTCTTTGGCTGAAATTTTTCTGG - Intronic
1019215630 6:170441296-170441318 TTCATTTGCTCATATTTTATTGG - Intergenic
1019742788 7:2683039-2683061 TTCTGTGGCTCGAGTTTGCTGGG + Intronic
1020535656 7:9393239-9393261 TTCTTTGGCACTATTTTTATAGG + Intergenic
1020592366 7:10157001-10157023 TTTTGTGGCTCTAATTTCCTTGG - Intergenic
1022149792 7:27590241-27590263 TTCTGAGTCTCAACTTTTCTGGG - Intronic
1023006531 7:35876027-35876049 TTCTGTTGCTGACATTTTGTAGG + Intronic
1025216856 7:57063662-57063684 TGTGGTGGCTCTAATTTTATTGG - Intergenic
1025627685 7:63236447-63236469 TGTGGTGGCTCTAATTTTATTGG - Intergenic
1025654527 7:63507086-63507108 TGTGGTGGCTCTAATTTTATTGG + Intergenic
1025836319 7:65097111-65097133 TTCTGTGTGTCCTATTTTATAGG + Intergenic
1025906094 7:65786565-65786587 TTCTGTGTGTCCTATTTTATAGG + Intergenic
1026036232 7:66832429-66832451 TCCTCTGGCTCAATTTTGATTGG + Intergenic
1026170636 7:67951037-67951059 TACAGTGGCTGAAATCTTATGGG + Intergenic
1026413775 7:70156289-70156311 TGCTTTGGCTGAAATTTGATAGG - Intronic
1026983262 7:74538709-74538731 TCCTCTGGCTCAATTTTGATCGG - Exonic
1027484027 7:78737123-78737145 CTCTAAAGCTCAAATTTTATTGG - Intronic
1028428852 7:90722855-90722877 TTCTCTTGCTTAAATTGTATAGG + Intronic
1029602644 7:101577943-101577965 TTTTGTGCCTAAAGTTTTATTGG + Intergenic
1029692510 7:102191622-102191644 TTCTCTGGCTCAAAATTAAAAGG - Intronic
1029968662 7:104767429-104767451 TTCTGTGGATCACATGATATCGG - Intronic
1030900890 7:115121768-115121790 TTCTTTCCATCAAATTTTATAGG - Intergenic
1032089709 7:128905201-128905223 TTCTGAAGTTCAAATTTTACTGG - Intronic
1033259461 7:139830037-139830059 TTCAGGGTCTCAAATTTTGTAGG - Intronic
1033915991 7:146326656-146326678 TTCTGTGGCAAAAGTTTGATTGG - Intronic
1034717351 7:153255952-153255974 TGGTGTGGCTGAGATTTTATAGG - Intergenic
1038219391 8:25593125-25593147 TTCTGAAGCTCAAATCTTAGAGG + Intergenic
1041597135 8:59668021-59668043 CTCTCTGGCTCAAATTGCATAGG - Intergenic
1042180704 8:66084621-66084643 TTTGGTGGCTGAATTTTTATGGG - Intronic
1042583708 8:70311170-70311192 TTCTTTGCCTCAAATATTACTGG - Intronic
1043228539 8:77768103-77768125 CTCTGAGGCTCAATTTCTATTGG - Intergenic
1043664651 8:82793442-82793464 TGCTGTGGCTCACATTTTCTAGG + Intergenic
1044045651 8:87428352-87428374 TACTGATGCTAAAATTTTATGGG + Intronic
1044270832 8:90241313-90241335 TTCTGTGGCTCAGGTTCTATTGG + Intergenic
1045158918 8:99514071-99514093 TTCTTTGACTCAAATTTTTGTGG + Intronic
1045777276 8:105820695-105820717 TTCTTTGGATCAAATCTTCTTGG + Intergenic
1045792780 8:106004512-106004534 TTTTCTGGCTCAAATATTAGTGG - Intergenic
1046445782 8:114316378-114316400 TTCTGTTGCCAAAATATTATTGG + Intergenic
1051510356 9:17870741-17870763 TTCTGTTTCACTAATTTTATAGG + Intergenic
1051868562 9:21710372-21710394 TTTAGGGGCTCAAAGTTTATTGG - Intergenic
1053356487 9:37450241-37450263 GTCTGTGTCCCAAATTTTCTTGG + Intronic
1054735691 9:68747806-68747828 TACTGTGGATCAAATTCTAGAGG - Intronic
1055620091 9:78116044-78116066 TTGTGTTGTTTAAATTTTATGGG - Intergenic
1055730033 9:79270930-79270952 TGCTGATGCTCAAATTTTAGTGG - Intergenic
1056044280 9:82700972-82700994 TTCTATGCCTCAAATTTTGGAGG + Intergenic
1056662032 9:88550883-88550905 TTCTGTGGCTCAGACTTCCTTGG + Intronic
1056899865 9:90587960-90587982 TTCTGTGTCCCAATTGTTATGGG + Intergenic
1057985631 9:99710920-99710942 TTTTGTGACTAAAGTTTTATTGG - Intergenic
1058108755 9:101005893-101005915 TTCTTTGGGTTAAAATTTATTGG - Intergenic
1058187022 9:101867039-101867061 TTCTGTGCCTCAAATGTAAAAGG + Intergenic
1059221223 9:112621223-112621245 CTCTGTGGCTCCAAATGTATGGG - Intronic
1060333433 9:122698004-122698026 TTCTATGGCTAATATTTAATGGG - Intergenic
1203687453 Un_GL000214v1:8473-8495 TTCTGTACCTAAAAATTTATGGG + Intergenic
1203648822 Un_KI270751v1:95580-95602 TTCTGTACCTAAAAATTTATGGG - Intergenic
1186130669 X:6462055-6462077 TTCTCACGCTCCAATTTTATAGG + Intergenic
1187582315 X:20621223-20621245 TTCTGGGGCCCTAATTTAATAGG - Intergenic
1188255059 X:27952010-27952032 TTCTGTAGCTCAAAATTGTTGGG + Intergenic
1189098369 X:38163454-38163476 ATCTGTGCCTTAAAGTTTATGGG - Intronic
1189602142 X:42638539-42638561 TACTGTGGCTCTTATTTCATTGG + Intergenic
1189646621 X:43140000-43140022 TTGAGTGGCTCACCTTTTATTGG + Intergenic
1190359301 X:49634263-49634285 TTCTCTGGCTCTAATCCTATTGG + Intergenic
1190859647 X:54331952-54331974 TTCTGTTGCTCAAATTCCAGTGG - Intronic
1193633466 X:83919048-83919070 TTCTTTGGGTTAAATTTTATTGG - Intergenic
1194777760 X:97986285-97986307 TTCTGTGGTTCGGTTTTTATTGG + Intergenic
1194780636 X:98021754-98021776 TTCTTTGGGTTAAATTTTCTTGG + Intergenic
1195508129 X:105682641-105682663 TTGTGTGGCTAAAATATTATTGG - Intronic
1196314461 X:114206449-114206471 TACTGTGGCTCCTATGTTATTGG - Intergenic
1197657301 X:129130871-129130893 TTTTGTAGCTCAAGTTTTATCGG + Intergenic
1198793611 X:140372458-140372480 TTCTGTGAATAAAGTTTTATTGG - Intergenic
1200796403 Y:7344934-7344956 GCATGTGCCTCAAATTTTATTGG + Intergenic