ID: 1064607519

View in Genome Browser
Species Human (GRCh38)
Location 10:17059341-17059363
Sequence TTTCTGTGGCTCAAATTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064607519_1064607522 -2 Left 1064607519 10:17059341-17059363 CCATAAAATTTGAGCCACAGAAA No data
Right 1064607522 10:17059362-17059384 AATAGGATAAGCTGATCCTCTGG No data
1064607519_1064607526 21 Left 1064607519 10:17059341-17059363 CCATAAAATTTGAGCCACAGAAA No data
Right 1064607526 10:17059385-17059407 AGAGAGGAATGCATCTCATAGGG No data
1064607519_1064607523 5 Left 1064607519 10:17059341-17059363 CCATAAAATTTGAGCCACAGAAA No data
Right 1064607523 10:17059369-17059391 TAAGCTGATCCTCTGGAGAGAGG No data
1064607519_1064607525 20 Left 1064607519 10:17059341-17059363 CCATAAAATTTGAGCCACAGAAA No data
Right 1064607525 10:17059384-17059406 GAGAGAGGAATGCATCTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064607519 Original CRISPR TTTCTGTGGCTCAAATTTTA TGG (reversed) Intronic
No off target data available for this crispr