ID: 1064607521

View in Genome Browser
Species Human (GRCh38)
Location 10:17059355-17059377
Sequence ATCAGCTTATCCTATTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 164}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064607521_1064607523 -9 Left 1064607521 10:17059355-17059377 CCACAGAAATAGGATAAGCTGAT 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1064607523 10:17059369-17059391 TAAGCTGATCCTCTGGAGAGAGG No data
1064607521_1064607528 24 Left 1064607521 10:17059355-17059377 CCACAGAAATAGGATAAGCTGAT 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1064607528 10:17059402-17059424 ATAGGGAGACTCTAGATTATGGG No data
1064607521_1064607527 23 Left 1064607521 10:17059355-17059377 CCACAGAAATAGGATAAGCTGAT 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1064607527 10:17059401-17059423 CATAGGGAGACTCTAGATTATGG No data
1064607521_1064607529 25 Left 1064607521 10:17059355-17059377 CCACAGAAATAGGATAAGCTGAT 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1064607529 10:17059403-17059425 TAGGGAGACTCTAGATTATGGGG No data
1064607521_1064607526 7 Left 1064607521 10:17059355-17059377 CCACAGAAATAGGATAAGCTGAT 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1064607526 10:17059385-17059407 AGAGAGGAATGCATCTCATAGGG No data
1064607521_1064607525 6 Left 1064607521 10:17059355-17059377 CCACAGAAATAGGATAAGCTGAT 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1064607525 10:17059384-17059406 GAGAGAGGAATGCATCTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064607521 Original CRISPR ATCAGCTTATCCTATTTCTG TGG (reversed) Intronic
904872561 1:33628247-33628269 ATCTCTTTATCCTTTTTCTGTGG - Intronic
907253402 1:53159219-53159241 ATCAGCTCATCTTTTTTATGAGG + Intergenic
907959140 1:59262181-59262203 ATCAGCTTCTCCTTTCTCAGTGG + Intergenic
909111096 1:71478604-71478626 ATCAGCATATCCTATTCCTCTGG + Intronic
910136221 1:83973366-83973388 ATCAGCTCATTATATTTATGTGG + Intronic
910378463 1:86598943-86598965 ATCAGTTAACCCTATTTCTGTGG - Intergenic
911488910 1:98537762-98537784 AACAGCTTCTCCTAATTCTCAGG - Intergenic
913414646 1:118591523-118591545 TTCAGCTTACCCTTTTTGTGAGG - Intergenic
916889181 1:169100155-169100177 ACCAACTTTTCTTATTTCTGGGG - Intergenic
917862086 1:179155895-179155917 TTCAGCTCATCCTTTTTTTGAGG - Intronic
920962716 1:210678492-210678514 ATGAGCTGATACTATTTTTGTGG - Exonic
923087692 1:230713866-230713888 ACCATCTTGTCCTATTGCTGAGG + Intronic
923833865 1:237588301-237588323 ATCATCTTATGCTATTTTGGGGG + Intronic
1064607521 10:17059355-17059377 ATCAGCTTATCCTATTTCTGTGG - Intronic
1067040261 10:42948600-42948622 ATCAGCTGGACCTATTGCTGTGG - Intergenic
1068749547 10:60576107-60576129 TTCAGCTTATGTTTTTTCTGAGG - Intronic
1069405735 10:68096131-68096153 ATCATGTCATCCTATTTATGGGG + Intergenic
1070053751 10:72914300-72914322 ATCACCTAAACCCATTTCTGTGG - Intronic
1070449382 10:76542798-76542820 ATCAGCTTTTCCCTTTTCAGGGG - Intronic
1075472864 10:122706096-122706118 ATCAGGCAACCCTATTTCTGGGG + Intergenic
1076145460 10:128115804-128115826 TGCAGCTGATCCCATTTCTGGGG - Exonic
1077997195 11:7464215-7464237 AGCTGCTTATCCCATTTCTCTGG - Intronic
1079037660 11:17034928-17034950 ATCAGTTTGTCCTATTACTGGGG - Intergenic
1081399438 11:42625828-42625850 AGCAGCTTATCCTTCTGCTGGGG + Intergenic
1087834499 11:102859081-102859103 ATCAGCAAATCCTTTTTCTATGG + Intergenic
1089336631 11:117729110-117729132 ATCAGTTGACCCTATTTGTGAGG - Intronic
1090792073 11:130099107-130099129 ATCATCTTATATTAATTCTGAGG + Intronic
1094802913 12:34058534-34058556 GTCACCTTATCCCATTTATGAGG - Intergenic
1099334152 12:81332161-81332183 CTCAGATCATCTTATTTCTGTGG + Intronic
1101283834 12:103288400-103288422 ATCAATTTATCCCATTTCTTTGG - Intronic
1104211741 12:126695429-126695451 ATCATCATATCCTATTAATGAGG + Intergenic
1110442209 13:75538236-75538258 AGCAGCTCATCCTATAACTGTGG - Intronic
1113144980 13:107198704-107198726 TTCAGCTTCTCTCATTTCTGGGG + Intronic
1113409401 13:110071594-110071616 GTCACCTTTTCCTACTTCTGAGG + Intergenic
1113613478 13:111664537-111664559 CTCTGCTAATCCTACTTCTGTGG + Intronic
1114334381 14:21672763-21672785 ATCATTTTTTTCTATTTCTGTGG + Intergenic
1114789031 14:25635269-25635291 TTCAGTTTATCCACTTTCTGGGG - Intergenic
1116016245 14:39410835-39410857 ATAATCTTATTGTATTTCTGTGG + Intronic
1117181732 14:53198690-53198712 TTCAGATTTTTCTATTTCTGAGG - Intergenic
1118014487 14:61644643-61644665 ATCTGCTTTTCTTAGTTCTGGGG - Intronic
1118903576 14:70006408-70006430 ATAAGCTTATTCCATATCTGAGG - Intronic
1120641009 14:87012798-87012820 TTCAGCTCATCCCATTTATGAGG + Intergenic
1120645624 14:87070704-87070726 ATCATGTTATCCTATCTCAGTGG - Intergenic
1126237225 15:46400311-46400333 ATGAGCTCATCCTTTTTTTGTGG - Intergenic
1128252707 15:66174178-66174200 ATCAGCAAATCCTATTTCCATGG + Intronic
1129657556 15:77534284-77534306 ATGTGCTTCTCCTATTTCTCTGG + Intergenic
1134249778 16:12566197-12566219 ATAAGCATATCCTAGTACTGTGG - Intronic
1136151430 16:28352946-28352968 ATCAAATTATCCAATTTTTGTGG + Exonic
1136167662 16:28466787-28466809 ATCAAATTATCCAATTTTTGTGG + Exonic
1136195314 16:28648228-28648250 ATCAAATTATCCAATTTTTGTGG - Exonic
1136211652 16:28762344-28762366 ATCAAATTATCCAATTTTTGTGG - Exonic
1136256372 16:29042295-29042317 ATCAAATTATCCAATTTTTGTGG - Exonic
1137577631 16:49613354-49613376 ATCAGTTGAGCATATTTCTGTGG - Intronic
1140366063 16:74381609-74381631 ATCAAATTATCCAATTTTTGTGG - Exonic
1143360658 17:6366703-6366725 GTGTGCCTATCCTATTTCTGGGG - Intergenic
1146698990 17:34937413-34937435 ATCAGTTTTTCATATTTGTGTGG - Intronic
1147020535 17:37528772-37528794 AACACCTTACACTATTTCTGTGG + Intronic
1148145251 17:45360667-45360689 ATCAGGTTATCCTAGGTGTGGGG + Intergenic
1148546487 17:48523060-48523082 TTCAGCTTTTGCTATTTCTGTGG - Intergenic
1149159578 17:53675273-53675295 ATCAGGTTAACCTATTCTTGTGG - Intergenic
1150648688 17:66995906-66995928 ATCAGTTCAACCTATTTGTGAGG + Intronic
1153578806 18:6550460-6550482 ACCAGCTTAAGCTATATCTGGGG + Intronic
1155077821 18:22377187-22377209 ATCAACTGATCATATTTATGTGG - Intergenic
1156024884 18:32641269-32641291 ATCAGCTTAGCATATTTGTGTGG + Intergenic
1158209772 18:55035256-55035278 ATCAGCTTGTCCTCTCTGTGTGG + Intergenic
1159027988 18:63204041-63204063 ATCTATCTATCCTATTTCTGTGG - Intronic
1160126209 18:76174714-76174736 ATCAGCTTATCAGATTACAGGGG + Intergenic
1163496633 19:17649695-17649717 ATCAGCGTATCTTTTTTTTGAGG - Intronic
1164667040 19:30047311-30047333 ATCATATTATCCTATATTTGGGG + Intergenic
1164742349 19:30585177-30585199 ATCAACTTAGCCTATTTCTTGGG - Intronic
927018768 2:18996298-18996320 AACAGCTTTTGATATTTCTGTGG + Intergenic
927146763 2:20171344-20171366 AACAGCTTGTCCTATTTTCGAGG - Intergenic
930333356 2:50014983-50015005 CTCATCTAATCCTATTTCAGTGG + Intronic
932197914 2:69800276-69800298 TTCAGTTTATCCTAATTCTTTGG + Intronic
932743354 2:74309325-74309347 ATCAGCTGATTATATTTGTGTGG + Intronic
935846004 2:107166352-107166374 TGCAACTTATCCTACTTCTGAGG + Intergenic
940057434 2:149527388-149527410 ATGAGGCAATCCTATTTCTGAGG + Intergenic
941079834 2:161047716-161047738 CCCACTTTATCCTATTTCTGAGG + Intergenic
941530416 2:166663042-166663064 ATCAGTTGATCATATTTATGTGG + Intergenic
942836862 2:180310491-180310513 ATTAGCTGACCCTATTACTGTGG + Intergenic
942942829 2:181639511-181639533 AACAGCTTATTCCATTTCTCTGG - Intronic
943891522 2:193292846-193292868 ATCAGCTTAACCTTCTTTTGTGG + Intergenic
1169078698 20:2780224-2780246 ATCAGCTGACCATATTTATGTGG - Intergenic
1170739250 20:19039766-19039788 ATCAGTTGATCTTATTTGTGTGG + Intergenic
1171537271 20:25905853-25905875 ATAATCTTTTCTTATTTCTGTGG + Intergenic
1171803839 20:29655439-29655461 ATAATCTTTTCTTATTTCTGTGG - Intergenic
1171840224 20:30201188-30201210 ATAATCTTTTCTTATTTCTGTGG + Intergenic
1172125676 20:32623892-32623914 AGAAGCTTCTCCAATTTCTGCGG + Intergenic
1173366764 20:42392935-42392957 ATCAGATTTTCCTCTTTCTTTGG - Intronic
1175241730 20:57554667-57554689 ATCTGCTTGTCCTGTTTCTGAGG + Intergenic
1175282820 20:57815478-57815500 ATCAGCTTTTCCTGGTTCTTTGG - Intergenic
1177647636 21:23919528-23919550 ATCAACTTTTTCTATTTCTATGG + Intergenic
1177828938 21:26115185-26115207 AACAGCTTACCCTATTATTGAGG - Intronic
1178784110 21:35636521-35636543 GTCAGCTTTCCCTATTTGTGGGG - Intronic
1179150197 21:38803459-38803481 AATGGCTTATCCTAGTTCTGGGG - Intergenic
1179334285 21:40435681-40435703 ATCAGCTGAGCATATTTGTGTGG + Intronic
949722953 3:7012001-7012023 AGCAGTTTAACCTGTTTCTGAGG - Intronic
949978708 3:9484800-9484822 ATCAGATGATTCTATTTGTGTGG - Intergenic
953093116 3:39749360-39749382 ATTGTCTTCTCCTATTTCTGTGG + Intergenic
953613764 3:44471122-44471144 GTCAGCTGATCCTGTGTCTGTGG - Intronic
956769957 3:72516919-72516941 ATTAGCTTTTACTATTTCTGTGG + Intergenic
957188360 3:76973112-76973134 CTCAGCTTATCTTCCTTCTGGGG - Intronic
960706980 3:120491202-120491224 ATCAAATTAACCAATTTCTGGGG + Intergenic
960873572 3:122275041-122275063 TTAAGCTTATTTTATTTCTGGGG - Intronic
964515652 3:157504892-157504914 ATCAGCCTAACCTAGTTTTGTGG + Intronic
964664090 3:159152814-159152836 AACTGCATATCCTGTTTCTGAGG - Intronic
965772505 3:172195740-172195762 AACAGCTCATCCTATTCCTCAGG - Intronic
971186119 4:24377961-24377983 TACAGATTATCTTATTTCTGTGG - Intergenic
971766637 4:30840660-30840682 TTCTACTTGTCCTATTTCTGAGG + Intronic
971781578 4:31041828-31041850 AGCAACTTTTACTATTTCTGAGG + Intronic
972887170 4:43507076-43507098 ATCAGCATATTCTAGTTCAGTGG + Intergenic
973029819 4:45323703-45323725 ATAAGCATATCATAGTTCTGAGG + Intergenic
974621835 4:64366077-64366099 ATCAGATTATTGTATTTGTGTGG - Intronic
975383564 4:73729619-73729641 CTCAGCTTTTCTCATTTCTGTGG - Intergenic
976179815 4:82388378-82388400 ATCATCTTTTCCTTTTTTTGTGG + Intergenic
976985278 4:91287781-91287803 ATTAGCTTAGCCTCTTCCTGTGG - Intronic
978230252 4:106389031-106389053 CTCAGCTTATCTGTTTTCTGGGG - Intergenic
980219491 4:129897451-129897473 ATCAGCTAAGTCTGTTTCTGAGG - Intergenic
982363277 4:154547192-154547214 ATCAACTTCCCTTATTTCTGAGG - Intronic
983250529 4:165340435-165340457 ATAAGATTATCATATTTCTAAGG + Intronic
983431263 4:167654517-167654539 TTCATCTTAAACTATTTCTGGGG - Intergenic
984492946 4:180458470-180458492 ACCAGCTCATCCCATTTCTCAGG + Intergenic
986143619 5:5055452-5055474 ATCAGTTTGTCCTATTATTGAGG - Intergenic
987363570 5:17128262-17128284 TGCAGTTTATCCTATTTATGAGG - Intronic
988381517 5:30502672-30502694 CTCAGCTTCTCCTTTATCTGGGG - Intergenic
988684871 5:33516413-33516435 ATCAACTTATTCTATTTCTAGGG + Intergenic
989756943 5:44966642-44966664 AACATCTTCTCCTATTACTGTGG - Intergenic
990072751 5:51805498-51805520 AACAGATTATCCGCTTTCTGTGG + Intergenic
991189379 5:63851597-63851619 AACAGGTTAGCCTATTTCTAAGG + Intergenic
992030605 5:72717598-72717620 CTCAGTTTAACATATTTCTGGGG + Intergenic
994109607 5:95986438-95986460 AGCAGCATATTCTATTTTTGTGG + Intergenic
994410250 5:99398791-99398813 ATCAGCTCAATCTCTTTCTGTGG + Intergenic
994483567 5:100366486-100366508 ATCAGCTCAATCTCTTTCTGTGG - Intergenic
995084831 5:108096656-108096678 ATCAGCTTTTCTTATTTGTGGGG + Intronic
999095388 5:148973375-148973397 ACCAGCCTATTCTAGTTCTGGGG + Intronic
999709871 5:154308549-154308571 AACAGCTTCTCCTAGTTCTCAGG - Intronic
1001073047 5:168603583-168603605 ATCAGCATGTCCTGTTTCTCTGG + Intergenic
1003079588 6:3010536-3010558 ATCAGCTTCTCAATTTTCTGGGG + Intronic
1003769874 6:9288414-9288436 ATCAGCCTCTCCTAATTCTCAGG + Intergenic
1004563675 6:16775442-16775464 CTCGCCTTATCCTATTTTTGTGG + Intergenic
1004572599 6:16862397-16862419 CTCAGGTTTTCCTATTTCTTGGG - Intergenic
1005043388 6:21619559-21619581 TTCAACTTTTCCTCTTTCTGCGG + Intergenic
1005771904 6:29082273-29082295 ATCATCTAATTCTTTTTCTGTGG + Intergenic
1008200383 6:48580610-48580632 ATCAGCTTTTCCTACTTCAGAGG - Intergenic
1008364570 6:50662341-50662363 AACAGCTGATCCTTTTTCTCAGG + Intergenic
1009011762 6:57851677-57851699 ATCAGCCTTTCTTATTTTTGAGG - Intergenic
1010525721 6:76898133-76898155 CACAGTTTATCTTATTTCTGTGG + Intergenic
1010985569 6:82420014-82420036 TTCAGCCTATCCTATTTCGTAGG - Intergenic
1015656666 6:135526208-135526230 ATCAGCTTTTCCTGGTTCTTGGG - Intergenic
1016622217 6:146124588-146124610 ATCAACTATACCTATTTCTGTGG + Intronic
1018993643 6:168693658-168693680 TTCAACATATCCTTTTTCTGGGG + Intergenic
1021816263 7:24450169-24450191 ATCAGCTCATCCTATGGGTGGGG - Intergenic
1022586245 7:31615498-31615520 ATTCTCTTATGCTATTTCTGTGG + Intronic
1023098330 7:36686577-36686599 ATCTGATTATGCTATTTCTGTGG - Intronic
1026531888 7:71206707-71206729 ATCAGGGTCTCATATTTCTGCGG + Intronic
1033077400 7:138262481-138262503 CTCACCATCTCCTATTTCTGAGG + Intergenic
1033496521 7:141902757-141902779 TTCATCTTATTCTATTTCTCTGG - Intergenic
1035148668 7:156847126-156847148 ATCAGTTGATCGTATTTATGTGG - Intronic
1037464410 8:19145617-19145639 ATCACTTCATCCTATTTATGTGG - Intergenic
1037828323 8:22173420-22173442 ATCAGCTTATAGAATTTCTTGGG - Intronic
1039270409 8:35874402-35874424 ATCAACACATCCTATCTCTGTGG + Intergenic
1041907104 8:63045662-63045684 AGCAGGTTATTCAATTTCTGTGG + Intergenic
1042778148 8:72458537-72458559 ATCAGTTGATTATATTTCTGTGG + Intergenic
1045820607 8:106332830-106332852 ATTTGCTTATCCTATCTCTATGG + Intronic
1046683799 8:117201985-117202007 TCCACCTTATCCCATTTCTGAGG + Intergenic
1046691258 8:117287588-117287610 CTTAGGTTATCCTATTTCTGAGG - Intergenic
1047308702 8:123674585-123674607 CTCAGCTTATCTACTTTCTGGGG + Intergenic
1048645453 8:136414553-136414575 ATCATCTTGTCCTCTTTGTGGGG + Intergenic
1051259532 9:15249407-15249429 ATCAACACATGCTATTTCTGAGG + Intronic
1051268973 9:15336460-15336482 ATCAGAATATCTTATTTCTCTGG - Intergenic
1058213930 9:102208192-102208214 ATCAGCTCACTTTATTTCTGTGG - Intergenic
1189746757 X:44176555-44176577 ATCAACTTTTTCTATTTCAGAGG + Intronic
1192377053 X:70573414-70573436 CTCAGGTTCTCCTATTTCTGTGG + Intronic
1192679781 X:73240322-73240344 ATCAGTTGATCATATTTCTGTGG + Intergenic
1194492608 X:94569900-94569922 CTCAGCTTAACCTCTTTCTTTGG + Intergenic
1195054651 X:101132012-101132034 ATCATCTCATCCTTTTTCTGAGG + Intronic
1195527256 X:105905602-105905624 ATCAGTTCATCCCATTACTGGGG - Intronic
1197002874 X:121459554-121459576 ATTAGATTAACCTATTTCTAGGG + Intergenic
1197878271 X:131135035-131135057 ATCAGCTGAGCATATTTGTGTGG + Intergenic
1198121468 X:133596624-133596646 ATCAGCTCTTCATATTTCTCAGG + Intronic
1199738341 X:150706936-150706958 ATCGGCTGAGCATATTTCTGTGG - Intronic