ID: 1064607523

View in Genome Browser
Species Human (GRCh38)
Location 10:17059369-17059391
Sequence TAAGCTGATCCTCTGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064607521_1064607523 -9 Left 1064607521 10:17059355-17059377 CCACAGAAATAGGATAAGCTGAT 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1064607523 10:17059369-17059391 TAAGCTGATCCTCTGGAGAGAGG No data
1064607518_1064607523 6 Left 1064607518 10:17059340-17059362 CCCATAAAATTTGAGCCACAGAA 0: 1
1: 0
2: 5
3: 24
4: 302
Right 1064607523 10:17059369-17059391 TAAGCTGATCCTCTGGAGAGAGG No data
1064607517_1064607523 30 Left 1064607517 10:17059316-17059338 CCACAAAGCAACAATGATATCAG 0: 1
1: 0
2: 2
3: 11
4: 233
Right 1064607523 10:17059369-17059391 TAAGCTGATCCTCTGGAGAGAGG No data
1064607519_1064607523 5 Left 1064607519 10:17059341-17059363 CCATAAAATTTGAGCCACAGAAA No data
Right 1064607523 10:17059369-17059391 TAAGCTGATCCTCTGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064607523 Original CRISPR TAAGCTGATCCTCTGGAGAG AGG Intronic
No off target data available for this crispr