ID: 1064609251

View in Genome Browser
Species Human (GRCh38)
Location 10:17080015-17080037
Sequence GAGCAGAAGCTGAGGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 959
Summary {0: 1, 1: 0, 2: 7, 3: 99, 4: 852}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064609251_1064609254 0 Left 1064609251 10:17080015-17080037 CCTTCCTGCCTCAGCTTCTGCTC 0: 1
1: 0
2: 7
3: 99
4: 852
Right 1064609254 10:17080038-17080060 TCCTGCTTTCCCAATTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064609251 Original CRISPR GAGCAGAAGCTGAGGCAGGA AGG (reversed) Intronic
900018480 1:170734-170756 GAGGAGAGGCAGGGGCAGGAGGG + Intergenic
900048738 1:529329-529351 GAGGAGAGGCAGGGGCAGGAGGG + Intergenic
900070969 1:771153-771175 GAGGAGAGGCAGGGGCAGGAGGG + Intergenic
900154144 1:1197383-1197405 GGGCAGAGGCTGGGGCTGGAGGG - Intronic
900523463 1:3117117-3117139 GAGCAGAAGAGCACGCAGGAGGG - Intronic
900546440 1:3231825-3231847 GTGGAGAAGCTGAACCAGGAAGG - Intronic
900567316 1:3339897-3339919 GTGCAGCAGCTGAGGTTGGAAGG + Intronic
900642332 1:3693733-3693755 GAGGAGGAGCTGAGGCTGCAGGG - Intronic
900642363 1:3693838-3693860 GAGGAGGAGCTGAGGCTGCATGG - Intronic
900661566 1:3787048-3787070 GAGAGGAAGCAGAGGCGGGAAGG - Exonic
900792348 1:4688910-4688932 GTGGAGAAACTGAGGCAGGGAGG + Intronic
901225410 1:7610481-7610503 GAGGAGAAACTGAGGCTGGGGGG - Intronic
901232822 1:7650691-7650713 GCGCAGAGGCTGAGGGGGGACGG - Intronic
901560586 1:10067126-10067148 AGGCAGAAGCTAAGACAGGATGG - Intronic
901634968 1:10666292-10666314 GAGAAGACCCTGAGGCAGGGAGG - Intronic
901640438 1:10690464-10690486 GATCAGAAGCTGGGCCAGGCTGG - Intronic
902100764 1:13986732-13986754 GAGCAGAAGCCAAGGAAGGATGG + Intergenic
902123102 1:14184509-14184531 GAGCGGAAGCAGCAGCAGGAGGG + Intergenic
902217852 1:14945711-14945733 GAGCAGCTGCTCAGGCAGGCTGG + Intronic
902359772 1:15936005-15936027 GGGCAGGAGCAGGGGCAGGAAGG - Exonic
902378286 1:16040622-16040644 GAGCAAAGGCTCAGGCAGGGTGG - Intergenic
902744675 1:18465710-18465732 GAGCAGAAGCCAAGGCCAGAGGG + Intergenic
902785575 1:18730761-18730783 GAGCAGAGGCTGTGGAAGGGGGG + Intronic
903320693 1:22541506-22541528 GGGCAGAAGCTGGAGGAGGAGGG - Intergenic
903347319 1:22695044-22695066 GAGCACATACTGAGGCAGGTCGG + Intergenic
903675424 1:25061739-25061761 GCTCTGAAGCTGAGGCTGGAGGG - Intergenic
903892835 1:26581346-26581368 GGGCAGGAGCTGAGGCGGGAGGG - Intergenic
904403278 1:30270708-30270730 GAGAAGATGATGAGGCAGGTAGG - Intergenic
904431308 1:30466258-30466280 GACCTGGAGTTGAGGCAGGAAGG - Intergenic
904686446 1:32264274-32264296 TAGGAGAATGTGAGGCAGGAAGG - Intronic
904856060 1:33499083-33499105 CAGAACAAGATGAGGCAGGACGG - Intergenic
904891909 1:33785641-33785663 GAGAAGAAACAGAGGCAGGGTGG + Intronic
905644687 1:39617069-39617091 GAGCAGAGGAAGAGGAAGGAAGG + Intergenic
906212525 1:44019988-44020010 GAGAGGAAGCTGAGGAAGGCTGG + Intronic
906302830 1:44696058-44696080 GGGCAGAAGTTGAGGGAGCAGGG + Intronic
906714434 1:47956382-47956404 GAGCATGAGCTGAAGCAGGGCGG + Intronic
906790196 1:48652478-48652500 GAGGAGGAGGTGAGGCAGGATGG + Intronic
906864737 1:49405543-49405565 GAGCAGCAGCAGTGGCAGCATGG - Intronic
906942455 1:50267411-50267433 CAGCAGGAGCAAAGGCAGGAAGG - Intergenic
907098361 1:51803110-51803132 GAGCATAAGATGAGGAAGTAAGG + Intronic
907104228 1:51866112-51866134 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
907112095 1:51935639-51935661 GAACAGAGACTGAGGGAGGAAGG + Intronic
907222084 1:52914506-52914528 CAGGATAAGCTGAGGCAGGAGGG + Intronic
907247045 1:53115119-53115141 GAGCAGAAAGAGAGGCTGGAAGG - Intronic
907277523 1:53325529-53325551 GTGAGGAAACTGAGGCAGGAGGG + Intronic
907333672 1:53687171-53687193 GAGCAGAACCAGAGCCAGGCAGG + Intronic
907373590 1:54018268-54018290 AAGCAGAGGCAAAGGCAGGAGGG + Intergenic
907385305 1:54121948-54121970 GAGCATAGGCAGAGCCAGGAGGG + Intergenic
907438185 1:54462701-54462723 GAGCAGGAGAGGAGGCTGGAGGG - Intergenic
908156680 1:61360521-61360543 AAGCAAAAGCTGGGGAAGGATGG - Intronic
908605123 1:65790448-65790470 GAGCAGAAGCAGAAGGAAGAAGG - Intergenic
908859444 1:68466450-68466472 CTACAGAGGCTGAGGCAGGAGGG + Intergenic
909519595 1:76551987-76552009 GAGCAGCAGCTGCTGCAGGTGGG + Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910484667 1:87700169-87700191 CTTCAGAAGCTGAGGCAAGAGGG + Intergenic
910650789 1:89564679-89564701 GCTCAAAGGCTGAGGCAGGAAGG + Intronic
910828950 1:91440381-91440403 AAGCAGGGGCTGAGGAAGGAGGG + Intergenic
910915074 1:92279626-92279648 GAGGGCAAGCTGAGGCAGGGCGG + Intronic
911743237 1:101410780-101410802 GCACAGAAGCTGTGGCAGGTGGG + Intergenic
911857561 1:102899810-102899832 GAGAATAAGGTGAGGCAGGAGGG + Intronic
912459934 1:109823856-109823878 GCGCAGAAGCGGAGGAAGGAAGG + Intergenic
914756171 1:150562639-150562661 GAGCAGAAGCTGCAGCCTGAGGG + Intergenic
915468540 1:156112557-156112579 CACCAGAAGCAGAGGCAGGAGGG - Intronic
915727092 1:158025665-158025687 GAGGAGAAGCAGAGGCCAGAGGG + Intronic
916505800 1:165427255-165427277 GAGAAGAAGCTGTGGCAGATGGG + Intronic
916707112 1:167362618-167362640 ACTCAGAGGCTGAGGCAGGAAGG - Intronic
918107532 1:181426999-181427021 GTGAAGAAGCTGAGGTGGGAAGG - Intronic
918123063 1:181556703-181556725 GGGAAGAAGTTGGGGCAGGAGGG + Intronic
918135566 1:181670917-181670939 GAGCAAGAGCTGAAGGAGGAAGG + Intronic
918183011 1:182101437-182101459 GGGAAGGAGCTGAGGCATGAGGG + Intergenic
918465808 1:184820432-184820454 GAGCAGAGGTAGAGGAAGGAAGG - Intronic
918912604 1:190592847-190592869 GAGCAGAGGTAGAAGCAGGAGGG - Intergenic
919055870 1:192569374-192569396 GAGAAGAAACTGAGGCTTGAGGG - Intergenic
919277934 1:195445142-195445164 GAGCATCAGCTGTGGCAGTATGG - Intergenic
919408062 1:197209193-197209215 GCACAGAAGCTGAGGCATGTGGG - Intergenic
919933603 1:202237087-202237109 GACCAGACACAGAGGCAGGAGGG - Intronic
920218486 1:204378096-204378118 GAGCAGAAGCTGGAGCGGGGAGG + Intergenic
920364273 1:205439933-205439955 GGGCAGAGGCTGAAGCTGGAAGG + Intronic
920373505 1:205493977-205493999 GAGCAGAAGCAGAGGAGAGAGGG - Intergenic
920436617 1:205950933-205950955 GTGCTGAAGCCGAGGCAAGAAGG - Intergenic
920526664 1:206672116-206672138 GAGGAGAAGCGGTGGCAGGGAGG - Intronic
920666456 1:207966101-207966123 GGGCAGGAGGTGAGACAGGAGGG + Intergenic
921461629 1:215433449-215433471 GAGGGCAAGCTGAAGCAGGATGG - Intergenic
922079074 1:222277063-222277085 GTGGGGATGCTGAGGCAGGAGGG + Intergenic
922164931 1:223107636-223107658 GAGCAGCAGGTGGGACAGGAGGG + Intergenic
922221727 1:223613499-223613521 CAGCAGAAACTGAGCCAGGCAGG + Intronic
922498113 1:226076542-226076564 TATAAGAGGCTGAGGCAGGAGGG + Intergenic
923314726 1:232768858-232768880 CAGTAGGAGCTGAGGCTGGAAGG - Intergenic
923738586 1:236635185-236635207 GAGCAGGAGATGTGGCTGGAGGG + Intergenic
923766982 1:236901529-236901551 GAGCAGGAGCTAAGACTGGAGGG - Exonic
923877275 1:238062833-238062855 GAGAAGGAGCAGAGGAAGGATGG - Intergenic
924323752 1:242875014-242875036 GGGCAGAAACTGAGGTAGGCTGG - Intergenic
924348513 1:243094168-243094190 GAGGAGAGGCAGGGGCAGGAGGG + Intergenic
924636670 1:245794668-245794690 CAAAAGCAGCTGAGGCAGGAGGG - Intronic
1063146721 10:3301722-3301744 GAGCAGAGGCTGGAGCAGAAAGG - Intergenic
1063165235 10:3455614-3455636 GAGCAGGAACTGCGGCCGGAAGG - Intergenic
1063784784 10:9368832-9368854 GAGCAGAATATGAGGTAGGTTGG - Intergenic
1063956164 10:11269655-11269677 GAGAAGAGGCTGGGGAAGGAGGG + Intronic
1064388603 10:14921738-14921760 GAGGAGAAGCTGGGCCAAGATGG - Intronic
1064609251 10:17080015-17080037 GAGCAGAAGCTGAGGCAGGAAGG - Intronic
1065362125 10:24898589-24898611 GAGGAGAAGCAGAGACAAGAAGG - Intronic
1066626822 10:37415536-37415558 GAGGAGAAGGAGGGGCAGGAAGG + Intergenic
1066727846 10:38410733-38410755 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1067084165 10:43229435-43229457 GGGCAGGAGCAGAGGCAGGCTGG + Intronic
1067338090 10:45380158-45380180 GAGGACAAGCTGTGGCAGGAAGG + Intronic
1067732575 10:48822635-48822657 GAGTAGAATCTGAGCCAGGTGGG + Intronic
1067991526 10:51218866-51218888 GAGAAGAAGGGGAGGAAGGAAGG + Intronic
1068787215 10:60989696-60989718 GTGCTGAAGCAGAAGCAGGAAGG + Intronic
1069855112 10:71435930-71435952 GAGCAGAGGCTGATGCCAGAGGG - Intronic
1070013261 10:72497637-72497659 GAGCAGAGGCTGAGGAAGATAGG + Intronic
1070287208 10:75092786-75092808 GTGCAGAATCTGAGGCTGCAGGG - Intergenic
1070335712 10:75453703-75453725 GAGCAGAAGGTGAGAGGGGATGG + Intronic
1070373833 10:75810097-75810119 GAGCAGAGTCTCTGGCAGGAAGG + Intronic
1071499435 10:86193050-86193072 TAGGAGATGCTGAGGCTGGATGG - Intronic
1071870604 10:89789972-89789994 GCACAGAAGCTGCGGCAGGTGGG - Intergenic
1072616043 10:97049438-97049460 GAGCACGAGCGGAGACAGGAAGG + Intronic
1072954258 10:99874890-99874912 GAGCAGCAGCTCAGGCAGTTGGG - Intergenic
1073199523 10:101723838-101723860 GAGGGAAAGCTGGGGCAGGATGG - Intergenic
1074284615 10:112086397-112086419 CTGGAGAAGCTGAGGCAAGAAGG + Intergenic
1074405641 10:113178256-113178278 GAGCAGATGCTGAGGACTGACGG + Intergenic
1074532241 10:114305639-114305661 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532268 10:114305726-114305748 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532403 10:114306211-114306233 GAGGAGATGCAGATGCAGGAGGG + Intronic
1075442406 10:122490622-122490644 GACCAGAGGCTGAGCCAGGTGGG + Intronic
1075657777 10:124173460-124173482 GGGCAGAGGCTGAAGGAGGAGGG - Intergenic
1076279057 10:129229959-129229981 GAGCAGCAGGAGAGGCAAGAGGG - Intergenic
1076313987 10:129527918-129527940 GAGGAGAGACTGAGGCAGGCAGG - Intronic
1076462506 10:130656382-130656404 GGGCTGACCCTGAGGCAGGATGG - Intergenic
1076717458 10:132373681-132373703 GAGTAGATGCTGAGAGAGGAAGG + Intronic
1076732938 10:132447285-132447307 GATTCAAAGCTGAGGCAGGAGGG - Intronic
1077063347 11:627108-627130 GAGCAGCAGCAGCAGCAGGAGGG + Exonic
1077304857 11:1864448-1864470 GGGCAGAGGCGGAGGGAGGAAGG + Intronic
1077306137 11:1869453-1869475 GAGCAGAAGCGGGTGCAGGGTGG + Intronic
1078157565 11:8811839-8811861 CTTCAGAGGCTGAGGCAGGAGGG - Intronic
1078195970 11:9137446-9137468 GTGCAGAAGCTGAGGCAGGCAGG + Intronic
1078243053 11:9547946-9547968 GCTCAGAGGCTGAGGCAGGAGGG + Intergenic
1078326159 11:10382851-10382873 GAGCTGAAACTCAGGAAGGAAGG - Intronic
1078331567 11:10426377-10426399 GAGGACAAGCTGAAGCAGGGTGG - Intronic
1078370683 11:10742172-10742194 GAGCAGAAGCTGAGGAATCGTGG + Intergenic
1078429109 11:11274029-11274051 GAGGACAAGCTGAAGCAGGGTGG + Intronic
1078608189 11:12796076-12796098 GTGCAGAAACTGGGCCAGGAGGG + Intronic
1078841556 11:15080318-15080340 GATCAGAGGCTGAGGGTGGAAGG - Intronic
1078921545 11:15835576-15835598 GAACAGAAGCTCAGACATGAAGG + Intergenic
1078929740 11:15903912-15903934 GAGAGGACGCCGAGGCAGGAGGG + Intergenic
1079271172 11:18987300-18987322 GCACAGAAGCCGGGGCAGGAAGG - Intergenic
1079384643 11:19968015-19968037 GATCAGAACCTGGGGCAGCAGGG - Intronic
1079397477 11:20077627-20077649 GAGCAGAAGGTAAGGCAGAAAGG + Exonic
1080346899 11:31335374-31335396 GAGGGGAAGCTGAAGCAGGGCGG - Intronic
1080922536 11:36723307-36723329 GAGGAGCAGCTCAGTCAGGAAGG + Intergenic
1081165975 11:39809813-39809835 GAGCACAAGCAGAAGCAGGGTGG + Intergenic
1081724809 11:45320869-45320891 CTGGAGAAGCTGAGGCAGCATGG + Intergenic
1081975416 11:47231292-47231314 GAGCAGTGGCTGAGTTAGGAGGG - Intronic
1082095615 11:48127044-48127066 GAGCAGGAGGTGATGGAGGAAGG + Intronic
1082809178 11:57468197-57468219 ATGGAGATGCTGAGGCAGGAAGG - Intronic
1083184086 11:61007591-61007613 GAGCAGCAGCTGCAGCGGGACGG + Exonic
1083261049 11:61523348-61523370 GAATGGAAGCTGAGGCAGGAGGG + Intronic
1083303124 11:61749091-61749113 GGGCAGAGGCTGGGGCAGGAAGG - Intergenic
1083331521 11:61900544-61900566 GAGGAGAGGCTGCGGCAGGAGGG + Intronic
1083585107 11:63851336-63851358 TAGTGGAGGCTGAGGCAGGAGGG + Intronic
1083602234 11:63955936-63955958 GAGCAGATGCTGAGGTCAGAGGG - Exonic
1084014384 11:66370041-66370063 GAGCAGAAGATGGGGCACAAAGG - Intronic
1084888677 11:72225696-72225718 AAGCAGAGGCTGAGGCTGTATGG + Intronic
1084950399 11:72662138-72662160 GAGGAGAAGCTGGGGCAGGGAGG + Intronic
1084969711 11:72764500-72764522 GTGAAGAAACTGAGGCAGGCCGG + Intronic
1086989700 11:93289419-93289441 TAGCAGAAGCTGAGTAAGTAAGG - Intergenic
1087252205 11:95915289-95915311 GAGCAGTTGCTGAGGTAGGGAGG - Intronic
1087274881 11:96151189-96151211 AGGCAGGAGCTGAGGAAGGATGG - Intronic
1088011402 11:105005665-105005687 CAGCAGAGGCTGTGGCAAGAAGG - Intronic
1088015882 11:105059307-105059329 CAGCAGAGGTTGTGGCAGGAAGG - Intronic
1088747997 11:112820575-112820597 GAGAAGCAGCAGATGCAGGAAGG + Intergenic
1089255168 11:117190305-117190327 GAGCTGAGGCTGCGGCAGGCAGG - Intronic
1089529249 11:119116011-119116033 GAGGGGAAGCTGAGGCAGAGAGG - Intronic
1089529447 11:119116841-119116863 GAGCAGGAGGGGAGGCAGGAAGG - Exonic
1089665737 11:120017493-120017515 GATGGGAAGCTGAGGCAGGATGG - Intergenic
1089775126 11:120830639-120830661 GAGGAGAATCGGAGGTAGGAAGG - Intronic
1090276996 11:125427225-125427247 GGGAAGGAGCGGAGGCAGGATGG - Intronic
1090432692 11:126659667-126659689 GATCAGAAGCAGAGTCAGAATGG + Intronic
1090603248 11:128394385-128394407 GAGCAGAGCCTGGGGCAGCAGGG - Intergenic
1090620109 11:128553122-128553144 GACGAGAAGCTGAGACAGAAAGG + Intronic
1091056125 11:132420699-132420721 GAGCAGATGGTGGGGTAGGAAGG + Intronic
1091134910 11:133179913-133179935 GAGCAGAAGGTAAAGCTGGAAGG + Intronic
1091268289 11:134287800-134287822 GGGCAGAGGGTGAGGCGGGAAGG + Intronic
1091364537 11:135006789-135006811 GATCGGAGGCTGAGGCTGGATGG - Intergenic
1091678339 12:2507924-2507946 GAGCAGAAGCTGCAGTAGGAAGG + Intronic
1092163345 12:6328036-6328058 GAACAGGGGCTGAGGCAGGAAGG + Intronic
1092247546 12:6872116-6872138 GAACAGAGGTTGAGGCAGGCTGG + Intronic
1092260697 12:6951930-6951952 GTGCAGGAGTAGAGGCAGGAGGG - Intronic
1092906771 12:13107460-13107482 TATGAGAAGCTGAGGGAGGATGG + Intronic
1093992927 12:25610310-25610332 GAGGGCAAGCTGAAGCAGGACGG - Intronic
1095097014 12:38154329-38154351 AAGCAGACGTTGAGGCAGCACGG + Intergenic
1095477040 12:42596173-42596195 GGGCAGAGGCTGAGGCATGTAGG + Intergenic
1096215948 12:49797363-49797385 GAGCAGCAGCTGAGGCCAGGAGG - Exonic
1096532057 12:52248493-52248515 GAGGGGCAGCTGGGGCAGGAGGG + Intronic
1096715189 12:53486946-53486968 GAGCACAAGCAGCAGCAGGAAGG - Exonic
1097014220 12:55974048-55974070 GAGGAGAAGGAGGGGCAGGAGGG + Exonic
1098041958 12:66361724-66361746 AAGCAGAGGCTGAGTCAGGAGGG - Intronic
1098753877 12:74332450-74332472 AAGCATAGGCTGAGGCAGGTAGG - Intergenic
1099215190 12:79844794-79844816 GAGCAGAGGAAGAGGCAGGAAGG - Intronic
1099477130 12:83121659-83121681 GAGCATAAGCTGTGGTAGTATGG + Intronic
1100160602 12:91855949-91855971 GAAAAGAAGCTGAGGGAGGTAGG + Intergenic
1100641432 12:96485300-96485322 AGGCAGAAGATGAGGCAGAAAGG - Intergenic
1101406346 12:104432523-104432545 GAGCAGGAGAAAAGGCAGGAGGG - Intergenic
1101961757 12:109256105-109256127 GGGCAGAAGCCCAGGCTGGAGGG - Intronic
1102052163 12:109870626-109870648 AAGCAGAAGGAGAGGAAGGAAGG + Intronic
1102346443 12:112163959-112163981 GAGAGGGAGATGAGGCAGGATGG - Intronic
1103520681 12:121535788-121535810 GGGCAGCAGTTGAGGGAGGAGGG - Intronic
1104143387 12:126009370-126009392 AACCAGGAGCTGAAGCAGGAGGG + Intergenic
1104620449 12:130307996-130308018 GAGCAGGAGCAGAGACAGGTCGG + Intergenic
1104666627 12:130652021-130652043 AAGATAAAGCTGAGGCAGGAGGG - Intronic
1104963110 12:132497561-132497583 AAGCAGGAGCTGAGGCCAGAGGG - Intronic
1104971747 12:132533944-132533966 GTGCAGAACCTGAGGCGGGTGGG + Intronic
1105002391 12:132699172-132699194 GAACATCGGCTGAGGCAGGAAGG + Intronic
1105050903 12:133049852-133049874 AAGCGGAAGTTGAGGGAGGAAGG - Intronic
1105294829 13:19078715-19078737 GATCAGAAGATTGGGCAGGATGG - Intergenic
1107195487 13:37646248-37646270 GAGAAGAACAGGAGGCAGGATGG - Intronic
1108008067 13:45972832-45972854 GGGCAGAAGCTGAAGCAGCAAGG - Intronic
1108234961 13:48394097-48394119 GAGGGCAAGCTGAAGCAGGATGG + Intronic
1108361805 13:49674721-49674743 GAGCTGTAGCTGAGGCAGTGAGG + Intronic
1108685705 13:52817369-52817391 GAACAGAGTCAGAGGCAGGAAGG + Intergenic
1110295217 13:73856230-73856252 TAGCAGAAGCTGTGGCTGGCGGG - Intronic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1110971914 13:81774536-81774558 TAAGAGAAACTGAGGCAGGAGGG - Intergenic
1111063816 13:83063463-83063485 CAGCAGCAGCTGAGACAGGAGGG - Intergenic
1111113456 13:83745819-83745841 GTGCAGTAGCTGATGCAGGCTGG - Intergenic
1112091823 13:96090944-96090966 GTGCAGGAGCTGGTGCAGGAGGG - Exonic
1112140432 13:96635398-96635420 CAGCATAAGCTAAGGCAGAAGGG - Intronic
1112504908 13:99969780-99969802 CAGCAGCAGCTGGAGCAGGAAGG - Intronic
1112683074 13:101789374-101789396 GATCAGAAACTGGGGCATGAAGG - Intronic
1112845048 13:103631699-103631721 GTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1113037039 13:106062003-106062025 GAGCACAGCCTGAGGCAGGCAGG - Intergenic
1113149014 13:107241537-107241559 GGGCAGAAGCTGAGGCACAGTGG - Intronic
1113475332 13:110576475-110576497 CTCCAGAGGCTGAGGCAGGAGGG + Intergenic
1113545114 13:111142763-111142785 GAGGAGATGGTGAAGCAGGAGGG - Intronic
1113680143 13:112238230-112238252 TGGCAGAAGGTGAAGCAGGAGGG + Intergenic
1113887494 13:113668487-113668509 CAGGAGGAACTGAGGCAGGACGG + Intronic
1114560952 14:23589937-23589959 GAGCAGAGGATGAGGGAAGAAGG + Intergenic
1114692287 14:24595276-24595298 GAGCATCAGCTGTGGTAGGATGG + Intergenic
1114757520 14:25276575-25276597 CAGAGGAAGCTTAGGCAGGAAGG + Intergenic
1115368800 14:32588971-32588993 GAGCAGAGGTAGAGACAGGAAGG - Intronic
1117454524 14:55884100-55884122 GAGCAGAAGCTGCCAGAGGAAGG - Intergenic
1118877632 14:69798156-69798178 GAGCAGAAGCAGAGAGAGGTGGG + Intergenic
1118915175 14:70096761-70096783 GAGGAGAGGCTGTGGCAGGTGGG + Intronic
1118994495 14:70823519-70823541 AAGCAGAAGCTGAGACAGGGAGG - Intergenic
1119002742 14:70897768-70897790 GTACAGAAGCAGAGGGAGGAAGG + Intergenic
1120119493 14:80661226-80661248 GAGCAGAAGAGGAGGAAAGATGG - Intronic
1121150348 14:91627723-91627745 GAGGAAAGCCTGAGGCAGGAGGG + Intronic
1121418773 14:93797813-93797835 ACGCAGAAGCTGTGGGAGGAAGG + Intergenic
1121487622 14:94330870-94330892 GCACAGAAGCTGAGCCAGGAGGG + Intergenic
1121487630 14:94330924-94330946 GCACAGAAGCTGAGCCAGGAGGG + Intergenic
1121586716 14:95067879-95067901 GGGCAGAAGCTCACCCAGGAGGG - Intergenic
1121643319 14:95500776-95500798 GAGCTGTAGCTGCAGCAGGAAGG - Intergenic
1122043627 14:99008159-99008181 GGGGAGAGGCAGAGGCAGGAGGG - Intergenic
1122473200 14:101986260-101986282 GGGCAGAAGCTGAAGCAGGATGG + Exonic
1122586031 14:102807245-102807267 GGGCTGAAGCTGGGGCAGCAGGG - Intronic
1122871315 14:104640371-104640393 GGGTGGAAGCTCAGGCAGGAGGG - Intergenic
1123682183 15:22770719-22770741 GAGCAGATGCGGGAGCAGGAGGG - Intergenic
1124589085 15:31037126-31037148 GAACAGGAGAGGAGGCAGGAGGG - Intronic
1124925446 15:34066050-34066072 TAGTAGAATCTCAGGCAGGACGG + Exonic
1124987622 15:34637085-34637107 GATCAGAAGCTCAGGGAGAATGG + Intergenic
1125152803 15:36552340-36552362 GAGAACCAGTTGAGGCAGGAAGG + Intergenic
1125261033 15:37824948-37824970 AAGTAGAAGCTGAGTCATGAGGG - Intergenic
1125722977 15:41853944-41853966 GAGAAGAGGCTGAAGCAGGCTGG + Intronic
1125726526 15:41871123-41871145 GAGCAGGAGCTGTGGGAAGATGG - Intronic
1125796233 15:42406062-42406084 CAGCAGAAGCTCAGGAAGGAGGG - Intronic
1125819916 15:42620371-42620393 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
1125824171 15:42661550-42661572 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
1126010349 15:44296716-44296738 GAGCAAAGGGTGAGGCAGGTAGG - Intronic
1126988894 15:54347376-54347398 TAGCAGAATCTTAGGCAGAAAGG - Intronic
1127203381 15:56684033-56684055 GTGCAGAAGCTGAGGCAAGAAGG + Intronic
1127322775 15:57863662-57863684 GAGCGGAAGTAGAGGCAGGCAGG + Intergenic
1127714913 15:61640592-61640614 GAGCAGAGACTGAGTGAGGAAGG + Intergenic
1127891318 15:63254032-63254054 GGGCACAAGCTGAGGCTGAAGGG - Intronic
1128058236 15:64716870-64716892 GAGCACAGGATGAGGCTGGAGGG - Intergenic
1128159116 15:65411411-65411433 GAGCAGAGGCTGTGGGAGGTGGG - Intronic
1128796468 15:70470120-70470142 ATGCAGGAGCTGAGGGAGGATGG - Intergenic
1129141447 15:73601837-73601859 GACTAGAAGCTGATGCTGGAGGG + Intronic
1129298698 15:74613481-74613503 GGGTAGAATCTCAGGCAGGATGG + Intronic
1129919913 15:79311278-79311300 GAGCAGCAGCAGAAGCAGCACGG - Exonic
1130013264 15:80168658-80168680 CAGCATAAGCTGAGACAAGAAGG - Intronic
1130042537 15:80417506-80417528 GAGAAGAAGCAGAGGGGGGATGG - Intronic
1131019483 15:89086520-89086542 GTGGGGAGGCTGAGGCAGGAGGG - Intergenic
1131176046 15:90210459-90210481 GAGCAAAGCCTGAGGCAGGAGGG + Intronic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1132237870 15:100235455-100235477 GGGCAGCACCTGAGACAGGAGGG - Intronic
1132414516 15:101610803-101610825 GTGCAGAGGGTGACGCAGGAAGG - Intergenic
1132467214 16:82893-82915 GAGCAAGAGAAGAGGCAGGATGG + Intronic
1132915200 16:2340373-2340395 GAGCCGAGGCCGCGGCAGGAGGG + Intronic
1133994746 16:10739933-10739955 GGGCCTGAGCTGAGGCAGGAGGG + Intergenic
1134255053 16:12603583-12603605 GAGAAGGCACTGAGGCAGGAAGG + Intergenic
1134686941 16:16165638-16165660 GAGGAGAAACAGTGGCAGGATGG + Exonic
1134823671 16:17267099-17267121 CAGCACAGGGTGAGGCAGGAAGG + Intronic
1135078486 16:19414093-19414115 GAGCAGACGCTGGAACAGGAAGG - Intronic
1135159112 16:20077900-20077922 AAAAAAAAGCTGAGGCAGGAGGG - Intergenic
1135415907 16:22267768-22267790 GAGCTGGAGCTGAAGCAGCAGGG + Intronic
1135429899 16:22374346-22374368 GGGCAGCGGCTGAGGCGGGACGG - Exonic
1135538403 16:23311986-23312008 GAGCAGAGGCTGATGTAGGGAGG + Intronic
1135846287 16:25921594-25921616 GAGCAGAAGCTGGTGCAATATGG + Intronic
1136030008 16:27495907-27495929 GTGCAGCACCTGCGGCAGGAGGG + Intronic
1136096665 16:27961985-27962007 GAGGGGAAACTGAGGCAGAAGGG - Intronic
1136153195 16:28365481-28365503 AAGGAGAAACTGAGGCAGAATGG + Intergenic
1136209891 16:28749792-28749814 AAGGAGAAACTGAGGCAGAATGG - Intergenic
1136838026 16:33516405-33516427 TAGCGGAAACTGAGGCAGGCAGG + Intergenic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137504494 16:49041327-49041349 GAGCAGAAGCCCAGGGAGGAAGG + Intergenic
1137926661 16:52547173-52547195 GACCGGCGGCTGAGGCAGGAGGG - Intronic
1137955413 16:52824492-52824514 GAGGGGAAGGTGAGGAAGGAAGG - Intergenic
1138139936 16:54559452-54559474 GAGCAGAGGCCAGGGCAGGATGG + Intergenic
1139078145 16:63480445-63480467 GAACAGGTGCTGATGCAGGAAGG + Intergenic
1139239308 16:65374401-65374423 GACCAGAAACTATGGCAGGAGGG - Intergenic
1139531297 16:67543956-67543978 GGGCAGCAGCAGAGGAAGGAGGG - Intronic
1140863237 16:79037601-79037623 TCCCAGAAGCTGAGGCAGGATGG + Intronic
1141519729 16:84570668-84570690 GAACATCAGCTGAGCCAGGAGGG - Intronic
1141670320 16:85488194-85488216 AAGAAGAAGATGAGGCAGCAGGG - Intergenic
1141965806 16:87442181-87442203 CAGCAGAGTCTGAGGCTGGACGG + Intronic
1141992459 16:87618328-87618350 GGGCAGCAGCTGGGGGAGGAGGG + Intronic
1142417409 16:89949945-89949967 GAGCAGAAGCTAAGGCTGCGAGG + Intronic
1142426767 16:90005752-90005774 GAGTAGAAGAAGGGGCAGGATGG + Exonic
1142445178 16:90131729-90131751 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1203148202 16_KI270728v1_random:1816685-1816707 TAGCGGAAACTGAGGCAGGCAGG + Intergenic
1142546216 17:705344-705366 TCGGAGAGGCTGAGGCAGGAGGG + Intronic
1142724122 17:1799341-1799363 GATGAGAAACTGAGGCAGAACGG + Intronic
1142742693 17:1940424-1940446 GAGGGGAAACTGAGGTAGGAGGG - Intronic
1142927871 17:3256950-3256972 GACCAGTGGCTCAGGCAGGAGGG - Intergenic
1143115879 17:4581723-4581745 GAGCAGAAGCACAGTCAGGAAGG + Intergenic
1143176705 17:4959701-4959723 GAGCATAGGATGCGGCAGGAGGG - Intronic
1143179495 17:4975157-4975179 GACAAGAAGGGGAGGCAGGAGGG + Intronic
1143231049 17:5355475-5355497 GAGCAGTAAGTGAGGCTGGAAGG - Intronic
1143411820 17:6713713-6713735 GAGCAGATGCGGACGCGGGAGGG - Intergenic
1143453947 17:7053724-7053746 GACCAGAAGCCAAGGCAGGAGGG + Intergenic
1143566076 17:7721592-7721614 GCACAGAGGCCGAGGCAGGAAGG - Intronic
1143592297 17:7892898-7892920 CACCTGAGGCTGAGGCAGGAGGG - Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1143965687 17:10755266-10755288 GAGCTGTAGCTGAGGGAAGAGGG - Intergenic
1144118422 17:12125017-12125039 AAGCTGAAGCTGAGGGAAGAGGG - Intronic
1144184628 17:12785481-12785503 GAGGAGGAGGTGAGGAAGGACGG - Intergenic
1144206905 17:12985847-12985869 TAGCAGAAGGTGAGGCAGCTTGG + Intronic
1144472817 17:15559934-15559956 GAACATAAGGTGAGCCAGGAGGG + Intronic
1144630213 17:16867719-16867741 AAGCAGGAGCTGGGGCAGAAGGG + Intergenic
1144647528 17:16985574-16985596 GGGCAGAGGCTGGGACAGGATGG + Intergenic
1144837662 17:18165476-18165498 GACCAGAAGCAGAGGCTGGCAGG - Intronic
1144923663 17:18784771-18784793 GAACATAAGGTGAGCCAGGAGGG - Intronic
1146301989 17:31696568-31696590 GAGAAGATTCAGAGGCAGGAGGG + Intergenic
1146396159 17:32469108-32469130 GAGCAGAAGTTAAGGCAGCTCGG - Exonic
1146458002 17:33022044-33022066 GAGCAGAAGCTGGCCCAGGATGG + Intronic
1146742429 17:35298354-35298376 GAGAAGAGGATGAGGGAGGAGGG - Intergenic
1146980988 17:37161410-37161432 GAGCAGAAGATGAGGAGGTAAGG + Intronic
1147165744 17:38592281-38592303 GATCGGAAGCTGAGGGAGGAGGG + Intronic
1147317275 17:39626976-39626998 GAGGAGAGGCTGAGGGAGGGAGG + Exonic
1147426586 17:40348674-40348696 GGAAAGGAGCTGAGGCAGGAGGG - Intronic
1147818823 17:43229604-43229626 TTCCAGAGGCTGAGGCAGGAGGG + Intergenic
1147832106 17:43304306-43304328 TTCCAGAGGCTGAGGCAGGAGGG + Intergenic
1147833664 17:43314988-43315010 ATGCAGAAGCTGAGGCAGAGAGG - Intergenic
1147976355 17:44250332-44250354 GAGCAGCAGCTGAGGCCCCAGGG - Exonic
1148539471 17:48468438-48468460 GCACAGAAGCTGAGGCATGTTGG - Intergenic
1148582579 17:48753896-48753918 GAGAGGAAGATGAGGCAGGCGGG - Intergenic
1148778910 17:50110838-50110860 GGGCTGGAGCTCAGGCAGGATGG - Exonic
1149108367 17:52996689-52996711 GAGGAGAAGGTGAAGCATGATGG + Intergenic
1149602032 17:57899281-57899303 GAGCAGGGGCTGAGGCCGGGTGG - Intronic
1149680529 17:58503980-58504002 GAGAAGCAGCTGAGTCAGTAGGG - Intronic
1150652533 17:67019343-67019365 GAGGAGGAGGTGAGGGAGGAAGG - Intronic
1151724442 17:75876211-75876233 GAACAGAAGCTGGGACAGGTGGG - Intronic
1151761091 17:76103628-76103650 GAGGACAAGCTGAAGCAGGTGGG - Exonic
1151870353 17:76832661-76832683 GTGCAGAAGATGATGGAGGAAGG - Intergenic
1151897670 17:76991258-76991280 AAGCAGGAGCTGGGCCAGGAAGG - Intergenic
1152071062 17:78133785-78133807 GAGCCAAGGCTGAGGCTGGATGG + Intronic
1152148039 17:78581011-78581033 AGGCAGAAGCTGAAGAAGGATGG - Intergenic
1152223481 17:79081959-79081981 GAGCGGATGCTGGGGCAGGCTGG + Exonic
1152395558 17:80030761-80030783 GGGCAGAGGCAGAGGCAGGCAGG + Intronic
1152435388 17:80273297-80273319 GGGCAGGAGCTGAAGGAGGAAGG + Exonic
1152461234 17:80443597-80443619 GAGCAGAGGCGCAGGGAGGAGGG + Intergenic
1152756526 17:82089344-82089366 GTGGAGCAGCTGAGGAAGGAGGG - Exonic
1152769750 17:82160109-82160131 GAGAAGAAGCAGAGGCTGCAGGG + Intronic
1152813013 17:82391096-82391118 GAGGAGGTGCTGAGGGAGGAGGG + Intronic
1153342410 18:3989027-3989049 GTGCAGCAGTGGAGGCAGGAGGG - Intronic
1153509125 18:5833305-5833327 CAGCAGAAACTAAGACAGGAAGG + Intergenic
1153647306 18:7206765-7206787 GAGAAGAGGCTTAGCCAGGAAGG - Intergenic
1153790118 18:8571345-8571367 GATCAGCACCTGTGGCAGGAAGG - Intergenic
1154424361 18:14260736-14260758 GAGCAGGAGCTGGGGCTGCAGGG - Intergenic
1155043577 18:22085095-22085117 GGGCAGAAGCAAAGGCAGGAGGG + Intergenic
1155304463 18:24465379-24465401 GCGCAGGATCTGAGGCAGAAGGG + Intronic
1156238678 18:35229766-35229788 ACTCAGAAGCTGAGGCAGGGGGG + Intergenic
1156268007 18:35505541-35505563 GGGCAGACGCTGAGCCAGGCTGG - Intergenic
1156350728 18:36298635-36298657 GAGCAGTCGCTGTGGGAGGAGGG + Intronic
1157174238 18:45436760-45436782 AAGCAGAAGCTGAGTAAGGATGG + Intronic
1157449225 18:47772895-47772917 GTGCAGAGGCTGAAGCAGGAAGG + Intergenic
1157481040 18:48053978-48054000 GCGCAGAGGCTGAGTGAGGATGG + Intronic
1157507457 18:48238815-48238837 GCAGAGAAGCTGTGGCAGGAGGG + Intronic
1157551124 18:48582505-48582527 GAGGGGACCCTGAGGCAGGAGGG - Intronic
1157602252 18:48901514-48901536 GGGTAGAGGCTGAGGTAGGAAGG - Intergenic
1157618606 18:49002438-49002460 CAGCAGAAACAGAGGCAGCAGGG - Intergenic
1157746277 18:50138840-50138862 CAGCCCAGGCTGAGGCAGGATGG - Intronic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158907329 18:62026689-62026711 TAGCAGAGGCAGAGTCAGGAAGG - Intergenic
1160072872 18:75643583-75643605 GAGCAGAGACTGAAGGAGGAGGG - Intergenic
1160083400 18:75752761-75752783 GAGCAGAGGCTGGAGGAGGAGGG + Intergenic
1160135301 18:76266355-76266377 GAGAAGAAGGGGAGGGAGGAAGG + Intergenic
1160513526 18:79465912-79465934 GAGCTGAAGCTGCCGCCGGAGGG - Intronic
1160624239 18:80192294-80192316 GAGCTGGAGCTGAGGCCAGAAGG - Intronic
1160696314 19:486300-486322 GTGCAGAGGCTGAGTCCGGAGGG - Intergenic
1160757479 19:765194-765216 GAGCAGAGACTGAGGGAGGAGGG + Intergenic
1160939837 19:1615068-1615090 GAGGGGATGCTGAGGCAGGCAGG + Intronic
1161316410 19:3619568-3619590 GAGCTGAAGCAGAGGCAGGCTGG + Intronic
1161322173 19:3646368-3646390 TAGGGGAGGCTGAGGCAGGATGG + Intronic
1161526560 19:4759731-4759753 GAGCGGGAGCTGAGGGAGGGAGG + Intergenic
1161823666 19:6547287-6547309 GATGAGAAGCTGAGGCAGGAAGG + Intergenic
1162059964 19:8088458-8088480 TAACTGAAACTGAGGCAGGAGGG + Intronic
1162299318 19:9835319-9835341 GAGCAGGCGCTGCGGCAGGAGGG + Exonic
1162339915 19:10086223-10086245 GAGCAGAGGCGGAGCCAGGGCGG + Exonic
1162933474 19:13968766-13968788 TCGCAGAAGCAGAGGTAGGAAGG - Exonic
1163350755 19:16775371-16775393 AAGCAAAAGCAGAGGCAAGAGGG + Intronic
1163457931 19:17419765-17419787 GACTAGCAGCTGAGGCCGGAAGG + Exonic
1163609320 19:18292830-18292852 GAGGGGAAGCTGAAGCAGGAAGG - Intergenic
1163653911 19:18534478-18534500 GATCTGCAGCTGAGACAGGAAGG - Intronic
1164160273 19:22621648-22621670 GAGCAGAACCTGGGGCAGAGAGG - Intergenic
1164707628 19:30332186-30332208 GATCAGTAGCTGAGGCCGGGGGG - Intronic
1164897960 19:31893777-31893799 GAGCAGAAGAGGAAGAAGGAGGG + Intergenic
1164951215 19:32338614-32338636 GAGCTGAAGATGAGGCCAGAAGG + Intergenic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165091217 19:33389305-33389327 GACCGGGAGCTGAGGCCGGAGGG + Intronic
1165424166 19:35736875-35736897 GAGCCAGAGCTGAGTCAGGATGG - Intronic
1165831742 19:38733971-38733993 GAGGACAAGCTGAGGCTGGGTGG + Intronic
1165896697 19:39145736-39145758 GATCAGCAGCTGGGGCAGGAGGG + Intronic
1166188877 19:41162056-41162078 GAGCTGTAGCTGAGGTGGGAAGG - Intergenic
1166193865 19:41193755-41193777 GAGGAGAAGCTGATGCAGCTGGG + Intronic
1166329072 19:42068470-42068492 GGGCAGCAGCTGAGGAGGGAGGG + Intronic
1166344182 19:42155117-42155139 CAGCTGCAGCTGAGGCAGGTGGG - Intronic
1166536766 19:43579564-43579586 GAGGAGAAGCAGAGACAGGGAGG + Intronic
1166861922 19:45816050-45816072 GAACAGAAGCTGAAGCCGGGAGG - Exonic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167568603 19:50272601-50272623 AAGCTGAAGCGGAGGCTGGATGG + Exonic
1167578127 19:50327538-50327560 GAGCAGAAGATACTGCAGGAAGG + Intronic
1167642136 19:50687775-50687797 GGGGAGAAACTGAGGCAGGGAGG - Intronic
1167714098 19:51129932-51129954 GGGCAGAAGCTGGGGGAGGCTGG - Intronic
1168670066 19:58234277-58234299 AGGCAGAAGCTGAGGCAGATTGG - Intronic
925274763 2:2640986-2641008 GAGCAGAAGCAGAGGCAGAAGGG + Intergenic
925425519 2:3746283-3746305 GCGGAGGAGCTGGGGCAGGAGGG + Intronic
926318083 2:11726146-11726168 GGGCAGCAGCTGAGGTAGAAAGG - Intronic
926451163 2:13005935-13005957 GAGGAGGAACAGAGGCAGGAAGG - Intergenic
926653488 2:15371795-15371817 GAACAGAGGCTGAGGAGGGAGGG + Intronic
927045438 2:19273475-19273497 GAGCAGAGGCAGATCCAGGATGG + Intergenic
927140239 2:20125231-20125253 GAGGCGCAGCTGAGGCAGCAAGG - Intergenic
927478533 2:23432729-23432751 GTGCAGGTGCTGAGGCAGGAGGG + Intronic
927502430 2:23591611-23591633 GAGCAGACGCAGTGACAGGATGG - Intronic
927720550 2:25379230-25379252 GGGAAGATGCTGAGGAAGGAGGG + Intronic
927827173 2:26316951-26316973 AAGAGGAAGCTGAGGCAGCAGGG + Exonic
928916095 2:36472538-36472560 GTGCAGAAGCTTAAGCAGGAGGG - Intronic
929261732 2:39873439-39873461 GAGCAGCAGCAGCGGCAGCAAGG - Intergenic
929667144 2:43841837-43841859 GAGGAGGCGCTGAGGAAGGAAGG - Intronic
929924670 2:46198306-46198328 ATGGAAAAGCTGAGGCAGGAAGG - Intergenic
930482591 2:51967448-51967470 GGCAAAAAGCTGAGGCAGGAAGG + Intergenic
930710142 2:54543111-54543133 GGGCTGATGCTGAGGAAGGAAGG + Intronic
930893666 2:56421207-56421229 GAGCACGAGCTGAAGCAGGGTGG + Intergenic
931357454 2:61549599-61549621 AAGCTGAGGCTGAGGCAGAATGG + Intergenic
932134039 2:69213047-69213069 TCTGAGAAGCTGAGGCAGGAGGG - Intronic
932196147 2:69785801-69785823 GTCCAGAGGCTGAGGAAGGAGGG - Intronic
932402223 2:71488958-71488980 GAGGAGCAGCTGAAGGAGGAAGG - Intronic
932437061 2:71708085-71708107 GGGCAGAGACTGGGGCAGGATGG + Intergenic
932468684 2:71940013-71940035 GGGCAGAAGCAGGGCCAGGAGGG - Intergenic
932772526 2:74508340-74508362 GAGCAGATGCCGAAGGAGGAGGG + Exonic
932812309 2:74835158-74835180 GAGGAGAAGCTGACCCGGGAAGG + Intronic
933249598 2:80014256-80014278 GAGCAGAAGCTGCAGGAGGAAGG + Intronic
933861027 2:86467916-86467938 CTGGAGAAGCTGAGGCAGGGGGG + Intronic
934228299 2:90153980-90154002 GAGCAGAGGATGGGGCAGGCTGG - Intergenic
934228892 2:90159743-90159765 GAGCAGAGGATGGGGCAGGCTGG - Intergenic
934616094 2:95772192-95772214 GAAGAGAAGCAGAGGCAGGAGGG - Intergenic
934644802 2:96052368-96052390 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
934838213 2:97608457-97608479 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
935123560 2:100202624-100202646 GAGGGGAAACTGAGGCAGAAAGG + Intergenic
935660877 2:105465894-105465916 GAGCAGAGCCTCTGGCAGGATGG + Intergenic
935818437 2:106869570-106869592 GAGCAAAAGCAGCAGCAGGAGGG - Intronic
935855679 2:107270344-107270366 GAGCAGAGTCTGAGGGAAGAGGG + Intergenic
935892008 2:107688811-107688833 GAGCTGGAGCTGTGGTAGGAAGG + Intergenic
936005328 2:108882044-108882066 CTCGAGAAGCTGAGGCAGGAGGG + Intronic
936398168 2:112145377-112145399 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
936514534 2:113173636-113173658 GGGCAGAAGCGCAGGGAGGAAGG + Intronic
936894571 2:117412987-117413009 GTACAGAAGCTGAGGCCGGCAGG + Intergenic
937013285 2:118581000-118581022 GAGCAGAACAGGGGGCAGGATGG - Intergenic
937231631 2:120401363-120401385 GAGCAGAGTCTGAGGCAAGGTGG + Intergenic
937247928 2:120505529-120505551 GCGATGAAGCTGAGACAGGAAGG + Intergenic
937249593 2:120515134-120515156 GAGGAGAAGGTGGGGCAGAAGGG - Intergenic
937807205 2:126160627-126160649 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
937997751 2:127708021-127708043 GAGCACAAGCTGGGGCATGCGGG + Intronic
938256588 2:129864086-129864108 GACCAGAGGCTGAGGAAGGGAGG + Intergenic
938397949 2:130964322-130964344 GAGGAGAAGGAAAGGCAGGAGGG - Intronic
939375527 2:141360649-141360671 AAGCTGAGGCTGGGGCAGGAAGG + Intronic
940285721 2:152031525-152031547 CAGCACAACCTGAGGGAGGAAGG + Intronic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
940548861 2:155125901-155125923 GAGAAGAACCTGAGACAGGTAGG - Intergenic
941686691 2:168455722-168455744 AATCAGGAACTGAGGCAGGATGG - Intergenic
941800113 2:169650404-169650426 TTGCAGAAGCTGAGGCTGAATGG - Exonic
941920407 2:170845156-170845178 GAGCAGAAAGTAAAGCAGGAAGG + Intronic
942303681 2:174586173-174586195 GAGCAGCAGCTGAGGCGGGGTGG + Intronic
944550673 2:200841828-200841850 CTCCAGAGGCTGAGGCAGGAAGG + Intergenic
944876593 2:203968789-203968811 GAGCAGAGGCAGAGAGAGGAGGG - Intergenic
945153184 2:206810858-206810880 GAGCGGAGGCTGAGGAAGAATGG + Intergenic
945783315 2:214203853-214203875 GCACAGAAGCTGTGGCAGGTGGG + Intronic
945914536 2:215689196-215689218 ACTCAGAGGCTGAGGCAGGAGGG - Intergenic
945927326 2:215819167-215819189 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
946047982 2:216837098-216837120 TGGCACAAGATGAGGCAGGAAGG + Intergenic
946783591 2:223219129-223219151 GGGCAGAAGCTGGGGAAGGGAGG - Intergenic
947590979 2:231385623-231385645 GAGCAAAGGTTGAGGCAGGCTGG + Intergenic
947747326 2:232515315-232515337 GAGCAGAGAATGAGACAGGATGG - Intergenic
947858687 2:233342864-233342886 CTTCAGAAGCTGAGGTAGGAGGG - Intronic
947952733 2:234161942-234161964 GAGCACAGGCTGAGGGAGGAGGG - Intergenic
948399192 2:237670762-237670784 ACGCAGAAACTGAGGCAGGCAGG - Intronic
948777501 2:240297283-240297305 GAGCATAAGCTAAGCCAGCAAGG + Intergenic
948835157 2:240622837-240622859 GAGCAGAGGCTGGGGGCGGAGGG + Intronic
949042879 2:241857636-241857658 GAGGTGGCGCTGAGGCAGGAAGG + Intronic
1168948426 20:1780355-1780377 GAGAAGGACCTCAGGCAGGAAGG + Intergenic
1169191610 20:3661841-3661863 GAGCAGGAGGTCAGGAAGGAGGG - Intronic
1169544567 20:6637440-6637462 GAGCACCAGCTCAGCCAGGAAGG + Intergenic
1170536041 20:17341941-17341963 GAACAGCAGCTGAAGCAGGCTGG - Intronic
1170577316 20:17674302-17674324 GAGCAATGGCTGAGGCAGGGTGG - Intronic
1170924157 20:20707739-20707761 AAGCAGAAGCTGAGGCTGGCTGG - Intronic
1170999112 20:21396197-21396219 GCGCAGCAGCTGCAGCAGGAGGG - Exonic
1171091615 20:22290729-22290751 GAGCAGATGCTGTGGGAGGCTGG + Intergenic
1171431738 20:25087202-25087224 GAGCAGAAGAGGGGGCGGGAAGG - Intergenic
1172084030 20:32364644-32364666 CAGCTGAGACTGAGGCAGGAGGG - Intronic
1173224288 20:41152891-41152913 GTGCAAAGGCTGAGGCAGGAAGG + Intronic
1173317629 20:41959338-41959360 GAGGAGAAGCTAAGTCAGGGAGG + Intergenic
1173360254 20:42337823-42337845 GAGGAAAAGCAAAGGCAGGACGG + Intronic
1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG + Intronic
1173569457 20:44067177-44067199 AAGCAGAGCCTGAGGCAGCAGGG + Intronic
1173577188 20:44120082-44120104 GAGAAGAATGAGAGGCAGGATGG - Intronic
1173653846 20:44685307-44685329 GACCAGGAGAGGAGGCAGGACGG - Intergenic
1174031710 20:47633737-47633759 ACTCAGAAGCTGAGGCAGAAGGG - Intronic
1174244240 20:49164406-49164428 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
1174327164 20:49788657-49788679 GAGAAGAAGCTAGGACAGGAAGG + Intergenic
1174340537 20:49892453-49892475 GAGGAGAAGCTGAGCCTGGCTGG - Intergenic
1174427044 20:50439219-50439241 GAGCAGGAGCTGACACAGGCGGG - Intergenic
1174455004 20:50642663-50642685 GAGCAGGGGTGGAGGCAGGAAGG - Intronic
1174766101 20:53255418-53255440 GAGGAGAAGCTGATGAAAGAGGG + Exonic
1175365161 20:58448629-58448651 GCAGAGTAGCTGAGGCAGGAAGG - Exonic
1175458922 20:59136220-59136242 GGGTAGGAGATGAGGCAGGAGGG - Intergenic
1175611309 20:60353448-60353470 GAGCAGCAAATGAGGCAGGCAGG - Intergenic
1175659187 20:60797592-60797614 GAACAGAAGCCGAGTCAGCAGGG - Intergenic
1175783206 20:61696596-61696618 GGGCAGGAGCTGAGGCTTGAGGG + Intronic
1175857124 20:62127598-62127620 AAGCAGCGGCTGAGGCTGGAGGG - Intronic
1175988756 20:62777206-62777228 AAGGAGGAGATGAGGCAGGAAGG + Intergenic
1175988760 20:62777225-62777247 AAGGAGGAGATGAGGCAGGAAGG + Intergenic
1175988767 20:62777260-62777282 AAGGAGGAGATGAGGCAGGAAGG + Intergenic
1176121259 20:63455579-63455601 GAGGAGAAGTTGGGGCAGGGAGG + Intronic
1176668122 21:9706035-9706057 GAACAGACGCTGAGGAAGGCGGG - Intergenic
1176949578 21:15029364-15029386 GAGTAGAGGCTGAGTCAGCATGG - Intronic
1177232531 21:18341167-18341189 CCGGAGAGGCTGAGGCAGGAGGG - Intronic
1178470097 21:32884804-32884826 GAGCAGATGCTGGGACAGGCAGG + Intergenic
1178627053 21:34227140-34227162 GAGCAGCATCGGAGGCAGGAGGG + Intergenic
1178830722 21:36054313-36054335 GAGCAGAAGCTTAGGCATGAAGG - Intronic
1179030093 21:37712674-37712696 GAGGAGAAGGGGAGGAAGGAGGG - Intronic
1179030106 21:37712719-37712741 GAGGAGAAGGGGAGGAAGGAGGG - Intronic
1179317799 21:40260375-40260397 CAGCTGTGGCTGAGGCAGGAAGG - Intronic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1179934075 21:44591409-44591431 GAGCAGAGGCTGTAGCAGGCAGG + Exonic
1179939326 21:44628006-44628028 GAGGAGAAGCTGTAGCAGGCCGG - Exonic
1179940810 21:44638129-44638151 GAGCAGAGGCTGTAGCAGGCAGG - Exonic
1179977337 21:44875856-44875878 GAGAAGGAGCTGAGGGAGGAGGG - Intergenic
1180056509 21:45361782-45361804 GAGGGGCAGCTGAGGCAGCAGGG - Intergenic
1180065393 21:45409721-45409743 GAGGGGAAACTGAGGCAGCAAGG - Intronic
1180215055 21:46318434-46318456 GGGCAGCAGCTGAGGCAGAGGGG + Intronic
1180757909 22:18175875-18175897 AAGCTAAAACTGAGGCAGGAGGG + Intronic
1180768195 22:18359668-18359690 AAGCTAAAACTGAGGCAGGAGGG + Intergenic
1180778112 22:18502722-18502744 AAGCTAAAACTGAGGCAGGAGGG - Intergenic
1180810836 22:18760033-18760055 AAGCTAAAACTGAGGCAGGAGGG - Intergenic
1180931094 22:19592354-19592376 CTGTGGAAGCTGAGGCAGGAGGG - Intergenic
1180939059 22:19645033-19645055 GCACAGGAGGTGAGGCAGGAGGG - Intergenic
1181027145 22:20132749-20132771 GTGAAGAAGTTGAGGCTGGAGGG - Intronic
1181196985 22:21194288-21194310 AAGCTAAAACTGAGGCAGGAGGG - Intergenic
1181621453 22:24094306-24094328 GAGCAGATGAGCAGGCAGGATGG + Intronic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1182070922 22:27463058-27463080 CAGCAGAGGCTGAGGCAGGGAGG + Intergenic
1182454090 22:30438778-30438800 GAGCAGGAACTGAGGGAGGAGGG - Intergenic
1183044423 22:35208292-35208314 GTGCACAAGCTGTGGCAGCATGG - Intergenic
1183266500 22:36829615-36829637 GAGGAGTAGCTGAGGCAGAGAGG + Intergenic
1183316964 22:37142180-37142202 CAGCAGGAGCAGAGGCAGAATGG + Intronic
1183388904 22:37532371-37532393 TTCCAGAGGCTGAGGCAGGAGGG - Intergenic
1183529702 22:38346763-38346785 AAGCAGGGGCTGGGGCAGGATGG + Intronic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1183718063 22:39545857-39545879 GGGAAGAGGCTGCGGCAGGAAGG - Intergenic
1183724655 22:39581669-39581691 GGGCAGAAGCCCAGGTAGGATGG - Intronic
1183726777 22:39594324-39594346 GAGCAGAGGATGGGGCTGGAAGG + Intronic
1184107507 22:42376750-42376772 TAGAGGCAGCTGAGGCAGGAGGG + Intergenic
1184378984 22:44133208-44133230 AGGCAGAAGCAGAGGCATGAGGG + Intronic
1184494079 22:44827154-44827176 CAGCAGAAGCAGAGGCCGGAGGG + Intronic
1184797289 22:46739531-46739553 GAGCGGCAGCTGAGGGAGGGAGG - Intergenic
1185139056 22:49090132-49090154 GGGCAGGAGCTGAGCCGGGAAGG + Intergenic
1203229815 22_KI270731v1_random:100555-100577 AAGCTAAAACTGAGGCAGGAGGG + Intergenic
949707133 3:6831211-6831233 GAGGAAGAGCTGAGGCATGAGGG - Intronic
949803966 3:7934332-7934354 GAGGACAAGCTGAAGCAGGGCGG + Intergenic
949904668 3:8849035-8849057 GTGCAGAAGCAGAGACAGGGAGG - Intronic
950117183 3:10458905-10458927 AAGAGGAAACTGAGGCAGGAAGG - Intronic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950388223 3:12676369-12676391 CACCTGATGCTGAGGCAGGAGGG - Intergenic
950678646 3:14569715-14569737 GCGCAGAGGCTGAGGCTGGAAGG - Intergenic
950906162 3:16540425-16540447 GAGCAGGAGATGAGGCAGCCTGG + Intergenic
951500986 3:23386932-23386954 GATCAGAAGGTCAGGCAGCAGGG - Intronic
952277794 3:31894300-31894322 GAGGACAAGGGGAGGCAGGAAGG + Intronic
953029437 3:39168727-39168749 TGGCATAAGCTGGGGCAGGAGGG + Intergenic
953162001 3:40429557-40429579 TGGGAGTAGCTGAGGCAGGAGGG + Intergenic
953240830 3:41148002-41148024 TTTCAGAGGCTGAGGCAGGAGGG + Intergenic
953628818 3:44593737-44593759 GAGTAGAGGATGAGGCAGGAAGG + Intronic
954420860 3:50418405-50418427 TAGCACAAGCAAAGGCAGGAAGG - Intronic
955117310 3:56018416-56018438 GAATAGCATCTGAGGCAGGAAGG + Intronic
955234968 3:57131141-57131163 GAGGAACAGCTGAGGTAGGAGGG - Intronic
955450814 3:59064990-59065012 GCACAGAAGCTGTGGCAGGCAGG - Intergenic
955540648 3:59972587-59972609 GTTCAGAATCTGGGGCAGGATGG - Intronic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
956111980 3:65878976-65878998 CAGCAGGAGCTCAGGCAGCAGGG - Intronic
956176302 3:66476358-66476380 GAGGAGAGGCTAAGGGAGGAAGG - Intronic
956227322 3:66974513-66974535 GGGAAGGAGATGAGGCAGGAAGG + Intergenic
958081073 3:88747058-88747080 GAGCACAAGCTGAAGCAGGGTGG + Intergenic
958521092 3:95186523-95186545 CTGCAGAGGCTAAGGCAGGAGGG - Intergenic
958576243 3:95952497-95952519 GAGCAGATGCTGCAACAGGAGGG + Intergenic
958787476 3:98613350-98613372 GCACAGAAGCTGTGGCAGGCGGG - Intergenic
958802843 3:98776563-98776585 GAGGAGGAGCTGAGGTAGAAGGG + Intronic
958807059 3:98824007-98824029 GAGCACAGCATGAGGCAGGATGG + Intronic
959590354 3:108073449-108073471 TGGGAGAAGCTGAGGCAGTAAGG + Intronic
959815198 3:110666406-110666428 GCGCAGAAGCTGTGGCAGGCAGG + Intergenic
960822915 3:121753081-121753103 GAAAAGAAGCTGAGGAAAGAAGG + Intergenic
960998200 3:123353134-123353156 GACCAGAAGCCTAGGGAGGAAGG - Intronic
961035483 3:123638739-123638761 GAGGAGTAGGAGAGGCAGGAGGG - Intronic
961324726 3:126103384-126103406 GAGCAGAAGCTGCGACAGTCAGG - Intergenic
961567043 3:127771282-127771304 GAGCAGGACCAGAGGGAGGATGG - Intronic
961978132 3:131048245-131048267 GCACAGAAGCTGCGGCAGGTGGG - Intronic
962487600 3:135860382-135860404 GAGATGAAGCTGAGGCATCATGG - Intergenic
962978123 3:140463859-140463881 TAGCAGGAGCTGATGCTGGAGGG + Intronic
964080909 3:152755680-152755702 GAGCAGGAGCTGACGATGGAGGG - Intergenic
965007366 3:163043298-163043320 GAGCAGAAGATGTTTCAGGAGGG + Intergenic
965743060 3:171897129-171897151 GAACAAAAGCAGAGGTAGGATGG - Intronic
966293950 3:178395844-178395866 GAGCAGAACCTGTGACATGAAGG - Intergenic
966833710 3:184032865-184032887 GAGCAGAGACTGAGAGAGGAGGG - Exonic
966914969 3:184579624-184579646 GATGAGAAGCTGAGGCGGGCTGG + Intronic
967158753 3:186717195-186717217 GAGCAGAATCTGATGAAGGAGGG - Intergenic
968365794 3:198183859-198183881 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
968565325 4:1309574-1309596 GAGGAGGAGCAGAGGCAGGGAGG + Intronic
968752828 4:2399096-2399118 GGGCACAAGCTGGGGCAAGATGG + Intronic
968803125 4:2756042-2756064 GAGCAGCTGCGAAGGCAGGAGGG - Exonic
968869013 4:3231892-3231914 AAGCAGATCCTAAGGCAGGATGG + Intronic
968982278 4:3856773-3856795 GAGGAGGAGCTGAGGCATGTCGG - Intergenic
969206663 4:5652277-5652299 GAGGAGAGGCTGCGTCAGGATGG + Intronic
969657658 4:8507451-8507473 GAGCAGGCGCTGGGGGAGGATGG - Intergenic
969664495 4:8549368-8549390 GCAAAGAAGCTTAGGCAGGAAGG - Intergenic
970213157 4:13731713-13731735 AAGCAGAGGATGAGGCTGGAAGG + Intergenic
970566103 4:17334088-17334110 AAGCAGAGTCTGAGGCAGGATGG - Intergenic
970603519 4:17658845-17658867 GAGCAGCACCTGAGGGAGGAGGG - Intronic
970715642 4:18919265-18919287 GTGCATAAGCTGAGTTAGGATGG + Intergenic
971117762 4:23667939-23667961 TAACAGAAGCTAAGGCATGACGG + Intergenic
971237069 4:24852005-24852027 GAGAAGAAGCTGTGTAAGGAAGG + Intronic
971298016 4:25417230-25417252 TATGAGAGGCTGAGGCAGGAGGG - Intronic
971452409 4:26812288-26812310 CAGAGGAAGCTGAGGAAGGAAGG - Intergenic
971713464 4:30146705-30146727 TTTGAGAAGCTGAGGCAGGAGGG + Intergenic
972265540 4:37455442-37455464 GAACAGATGCTGAGACAGGAAGG + Intronic
972337035 4:38116308-38116330 GAGCAGATGCAGAGGCTGGGAGG - Intronic
973830284 4:54752502-54752524 CAGCAGCAGCTGAAGCAGGAGGG + Intergenic
975076332 4:70213192-70213214 GAGCATGAGCTGAAGCAGGGCGG - Intergenic
975795591 4:78003370-78003392 CTTCAGAGGCTGAGGCAGGAGGG - Intergenic
976337535 4:83908065-83908087 GAGCAGGAGCTCATTCAGGAGGG - Intergenic
976357572 4:84137131-84137153 GTGCAGAAGCAGAGGCAGGGTGG - Intergenic
976728836 4:88242758-88242780 GAGAAAGAGCTGACGCAGGAAGG + Intergenic
979254829 4:118599013-118599035 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
979577427 4:122310708-122310730 GAGAAGCAGCAGATGCAGGAAGG - Intronic
979588499 4:122449505-122449527 GAGCACATGCTGAGGAATGAAGG - Intergenic
980087893 4:128410324-128410346 GCACAGAAGCTGAGGCAGGTGGG - Intergenic
981755041 4:148133687-148133709 AACCAGAAGCTGGCGCAGGATGG + Intronic
981761483 4:148200125-148200147 TGGCAGAAGCACAGGCAGGATGG + Intronic
982491780 4:156038880-156038902 GAGCAGCAGCTGTGGTAGTATGG - Intergenic
982502641 4:156176110-156176132 GGGCAGATGCTGTGGCAAGAAGG + Intergenic
982699305 4:158641545-158641567 GAGCAGAACATGAGGAAAGAAGG - Intronic
982918932 4:161249955-161249977 CGGAAGAAGCTGAGGCAGCAGGG + Intergenic
982960369 4:161827905-161827927 GCACAGAAGCTGCGGCAGGCAGG - Intronic
984213560 4:176880171-176880193 GAGCAGCTGCTGAGGTAGGAAGG + Intergenic
984617284 4:181913200-181913222 ACGCAGAAGCCGAGACAGGAAGG + Intergenic
985045524 4:185936811-185936833 GAGCAGAAGCTGAGTGTGGGAGG - Intronic
985355689 4:189116681-189116703 GCACAGAAGCTGTGGCAGGCGGG + Intergenic
985406808 4:189646211-189646233 GAACAGATGCTGAGGAAGGCGGG + Intergenic
985406844 4:189646391-189646413 GAACAGATGCTGAGGAAGGCGGG + Intergenic
985429774 4:189868018-189868040 GAGAAGAAGCAGATGCAGGCAGG - Intergenic
985629099 5:1005551-1005573 GAGCGAAAGGCGAGGCAGGACGG + Intergenic
985767581 5:1787922-1787944 GAGCAGGAGGGGAGGGAGGAGGG - Intergenic
985816481 5:2131803-2131825 GAGCGGAAACAGAGGCAGCATGG - Intergenic
985878837 5:2621907-2621929 GAGCAGTAGCTGAACCTGGACGG - Intergenic
985981983 5:3477665-3477687 AAACAGAAGCTGAGAAAGGATGG + Intergenic
986084246 5:4427623-4427645 GAGCAGAGTCTGTGGCTGGAAGG - Intergenic
986326086 5:6675706-6675728 GAGCAAATGCTGAGATAGGAAGG - Intergenic
986376597 5:7138118-7138140 CAGCAGAAGCTGATGCTGAAGGG - Intergenic
986434421 5:7714534-7714556 GGGAAGAAGCTGAGGCACAAAGG + Intronic
986482652 5:8204350-8204372 TAGCAGAAGGTGAAGGAGGAAGG - Intergenic
987076381 5:14386106-14386128 GAGCAGAAGAATAGGCAGGGAGG + Intronic
987372614 5:17207262-17207284 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
989328060 5:40222912-40222934 GAATAGAAGCTGAGGCATGAAGG - Intergenic
989522504 5:42418395-42418417 GAGAATAAGCTGAAGCAGGGTGG - Intergenic
990334411 5:54757894-54757916 GAGCAGAAGCAGAGCAAAGATGG + Intergenic
991561424 5:67957701-67957723 GACAAGAAGCTGAGGCCGGAGGG + Intergenic
991931357 5:71756020-71756042 GAGTACAAGCTGAGACATGATGG - Intergenic
992409709 5:76493289-76493311 GAGCAGGAGATGAGGCCAGAGGG - Intronic
992783151 5:80146204-80146226 GAGCAGCAGCCGGGGAAGGAGGG - Exonic
992898598 5:81270147-81270169 GCACAGAAGCTGTGGCAGGCAGG + Intergenic
992943662 5:81788538-81788560 GAGGAAAACCTTAGGCAGGATGG - Intergenic
993484191 5:88462423-88462445 GAGCAGATGCTAAGGCTGTAAGG + Intergenic
994281849 5:97914026-97914048 TTCCAGAGGCTGAGGCAGGAGGG + Intergenic
994350230 5:98737357-98737379 GAGCATAAGCTGAAGCAGGGTGG + Intergenic
995502374 5:112821397-112821419 CTCCGGAAGCTGAGGCAGGAAGG + Intronic
995803084 5:116020801-116020823 GAGAAGAAGGAGAGGCAGAAAGG + Intronic
996327050 5:122286814-122286836 GCACAGAAGCTGTGGCAGGCAGG - Intergenic
996477831 5:123941541-123941563 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
997013273 5:129904170-129904192 GAGCAAGAGCTGGGGGAGGAGGG + Intergenic
997520518 5:134521207-134521229 GAGGCAAAGCTGAAGCAGGAAGG - Intergenic
997631262 5:135370362-135370384 GAACTGAAGCTGAGGGAGAAGGG + Intronic
997681090 5:135751212-135751234 GGGCCTGAGCTGAGGCAGGAGGG - Intergenic
997710029 5:135996402-135996424 GAGCAGCAGCAGAGGCTGAAAGG - Intergenic
997775930 5:136604996-136605018 GAGCAGAAAAAGAGGAAGGAAGG - Intergenic
997948736 5:138224933-138224955 TTCCAGAAGCTGAGGAAGGAGGG + Intergenic
998005899 5:138656933-138656955 GAGCAAGAGCTGAGGTAGGGAGG - Intronic
998215179 5:140232752-140232774 AAGAACTAGCTGAGGCAGGAAGG + Intronic
998324376 5:141266430-141266452 GAGAAGTAGCTGTGGAAGGAAGG + Intergenic
998328248 5:141301513-141301535 GAACGGAAGCTGGCGCAGGAAGG + Intergenic
999305418 5:150516200-150516222 GAGCAAGGGCTGAGGCAGGCAGG - Intronic
999868235 5:155725254-155725276 GAGAGCAAGCTGAGGAAGGATGG - Intergenic
1001055293 5:168444530-168444552 GAGCTGGAGAAGAGGCAGGAGGG + Exonic
1001101692 5:168819529-168819551 GCGCGGAAGCTGAGGCAACAGGG + Intronic
1002355353 5:178624539-178624561 GCGCAGATGCTGAGCCTGGAAGG - Intronic
1002372973 5:178769448-178769470 GCACAGAAACAGAGGCAGGAGGG + Intergenic
1002630519 5:180572655-180572677 GCGGGGAGGCTGAGGCAGGAGGG - Intronic
1002725019 5:181289079-181289101 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1003118900 6:3304174-3304196 GACCAGAGCCTGAGGCAGGAGGG + Intronic
1003134634 6:3424936-3424958 GAGCATTAGCTTAGGCATGAAGG - Intronic
1003450917 6:6230578-6230600 GAGCAGTAGCTGTGGTAGTATGG - Intronic
1004275814 6:14234180-14234202 CCACAGAAGCAGAGGCAGGAAGG + Intergenic
1005168686 6:22956178-22956200 TAGCAGAAGCTGGGGGAGGAGGG + Intergenic
1005833919 6:29693186-29693208 CTCCCGAAGCTGAGGCAGGAAGG - Intergenic
1005948313 6:30611664-30611686 GAGCAGCAGCAGAAGCAGGGAGG + Intronic
1006018741 6:31104051-31104073 TTGGGGAAGCTGAGGCAGGAGGG - Intergenic
1006034806 6:31202822-31202844 GGGCAGAAGGTGCGGCAGGAAGG - Exonic
1006073813 6:31516395-31516417 GGGCAGAAGCTGCAGCAGGAAGG - Intergenic
1006125874 6:31837731-31837753 GAGCAGCAGCAAAGGCAGGGAGG + Intronic
1006606976 6:35264897-35264919 GAGAAGAGGGTGAGGCAGTAAGG + Intronic
1006629033 6:35418237-35418259 GTGCAGATGCTGGGGCAGGCAGG - Intronic
1007197330 6:40074010-40074032 GCACAGAAGCTGTGGCAGGTGGG - Intergenic
1007344456 6:41217540-41217562 GAGCAGAAGACCTGGCAGGATGG + Intergenic
1007370116 6:41421260-41421282 AAGCAGAGCCTGAGGCAGGTGGG + Intergenic
1007397640 6:41586710-41586732 GAGCTGAAGCAGCGGAAGGAGGG + Intronic
1007585435 6:42986256-42986278 GAGGAGAAGCTGGGGGAGGCTGG - Intronic
1007619638 6:43204121-43204143 GAGCAGTGCCTGGGGCAGGAAGG - Intronic
1008067133 6:47061783-47061805 GGGGTGGAGCTGAGGCAGGAAGG - Intergenic
1008664336 6:53701243-53701265 TAGCAGAAGCAGAAGCATGAAGG - Intergenic
1009264031 6:61531638-61531660 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
1009447727 6:63763233-63763255 GAGCAGAAGCTGAGGGGTAATGG + Intronic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1010551731 6:77231704-77231726 GAGAAGACCCTGATGCAGGAAGG + Intergenic
1010671699 6:78694469-78694491 GAGCATGAGCTGAAGCAGGGCGG + Intergenic
1010748245 6:79588527-79588549 GAGAAGCAGCAGATGCAGGAAGG - Intergenic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013504738 6:110788268-110788290 TTTGAGAAGCTGAGGCAGGAGGG - Intronic
1013839040 6:114368156-114368178 GAGCTGAAGCTGAAGCTGGCTGG + Intergenic
1013974691 6:116063856-116063878 GAGAAGAAACTGAGGCTGAAAGG + Intergenic
1014296764 6:119627964-119627986 GAGTAGGAGCTGAAGCTGGAAGG + Intergenic
1014313233 6:119831003-119831025 GCACAGAAGCTGTGGCAGGCAGG - Intergenic
1014998670 6:128187207-128187229 GAGCAAAAGATGAGAGAGGAAGG + Intronic
1015254649 6:131164400-131164422 GAGCAGGTGCTGAGAGAGGAAGG + Intronic
1015601537 6:134915674-134915696 GAGGAGAAGCTGAGAAAAGATGG - Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016909109 6:149179395-149179417 GTGGAGAAGGTGAGGCAGGGAGG + Intergenic
1016911092 6:149200046-149200068 GCCCACAAGCTGAGGCAGGGTGG + Intergenic
1016936910 6:149454579-149454601 GAGCAGGAGCTGTGCCAAGAGGG + Intronic
1016988953 6:149916367-149916389 GAGGAGAGGCTGAGGAAGAAGGG - Intergenic
1017056507 6:150441448-150441470 CAGCAGAGGTGGAGGCAGGAAGG - Intergenic
1017456135 6:154603285-154603307 GAGAAGAAGCTAAGTCAGGAAGG - Intergenic
1017538221 6:155371460-155371482 GAGAAGAAGCTAAGCTAGGACGG - Intergenic
1017681583 6:156869996-156870018 GAGCAGTGGCTGGGGCAGGGTGG + Intronic
1017730170 6:157308632-157308654 CAGCAGAAGAGGAGGCAAGACGG + Intronic
1018026251 6:159808643-159808665 GAGCAGAAGCTGAGATGGAAAGG - Intronic
1018169235 6:161131315-161131337 CTGCAGGAGCTGAGGAAGGAAGG + Exonic
1018890031 6:167976703-167976725 GAGCAGGACCTGAACCAGGAAGG - Intergenic
1019190429 6:170247644-170247666 GGGCAGCAGCAGAGGCAGGAGGG + Intergenic
1019368034 7:645242-645264 GAGCCGAAGACGCGGCAGGAGGG + Intronic
1019481574 7:1269495-1269517 GAGCTGAACTTGCGGCAGGAGGG - Intergenic
1019564782 7:1673918-1673940 GAACCCAGGCTGAGGCAGGAGGG + Intergenic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1020219759 7:6226733-6226755 CAGCAGAACCTGAGCAAGGAAGG + Intronic
1020413951 7:7924635-7924657 GAACAGAAGCTCTGGCAGGGAGG + Intronic
1020470317 7:8527263-8527285 AAGCAAAAGCTGAGGCTGCATGG - Intronic
1020474714 7:8581916-8581938 TAGCACAAGCAGAGGCAGCAGGG - Intronic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1021067721 7:16197577-16197599 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021067882 7:16198794-16198816 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021631319 7:22650222-22650244 AAACAGAATCTGAGGCAGGCTGG + Intergenic
1021986374 7:26101817-26101839 GGGCAGAAAGTGAGGGAGGATGG + Intergenic
1022171705 7:27837792-27837814 CAGCAGCAGCAGATGCAGGAAGG + Intronic
1022495961 7:30853320-30853342 GAGCAGAAGCTAATTCAGGATGG + Intronic
1022642864 7:32204734-32204756 GAGCATTAGCTGAGGCTTGAGGG - Intronic
1022657529 7:32333654-32333676 GAGCAGAAACTGAGTCAAGGAGG - Intergenic
1023203758 7:37725852-37725874 TAGCAGTAACAGAGGCAGGAAGG - Intronic
1023251680 7:38269992-38270014 CTCGAGAAGCTGAGGCAGGAGGG + Intergenic
1023849592 7:44142798-44142820 CTCCAGAGGCTGAGGCAGGAAGG - Intergenic
1024069920 7:45776692-45776714 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1024325673 7:48107537-48107559 GAGCAGAAGTGAAGGGAGGAGGG - Intronic
1024645014 7:51363602-51363624 GAGAAGAAGCAGAGGCAGCTAGG - Intergenic
1024825062 7:53381568-53381590 GTGCAGAAGCTGAGGGAAAAAGG - Intergenic
1025116559 7:56263385-56263407 CAGCAAAAGATGATGCAGGAGGG - Intergenic
1025187379 7:56871520-56871542 GAGGAGAGGCTGGGGCAGGAGGG + Intergenic
1025188792 7:56881324-56881346 GAGGAGAGGCCGGGGCAGGAGGG + Intergenic
1025683143 7:63695596-63695618 GAGGAGAGGCTGGGGCAGGAGGG - Intergenic
1025684546 7:63705400-63705422 GAGGAGAGGCTGGGGCAGGAGGG - Intergenic
1026038352 7:66845837-66845859 GAGGAGACGCAGGGGCAGGAAGG - Intergenic
1026396129 7:69956114-69956136 AAGCAGCAGCTGAGGCATGTTGG - Intronic
1026498405 7:70922658-70922680 GGGCACCAGCTGAGGGAGGATGG - Intergenic
1026531276 7:71199562-71199584 GAGCAGAAGGGTAGGCAGGATGG - Intronic
1026545174 7:71316141-71316163 GAGCAGGAGCAAAGGGAGGAAGG + Intronic
1026760621 7:73123244-73123266 GAGCAGAAGCAAATGCATGAAGG + Intergenic
1026895387 7:74007300-74007322 GAGAATGAGCTGAGGCAGGTGGG - Intergenic
1027036965 7:74932065-74932087 GAGCAGAAGCAAATGCATGAAGG + Intergenic
1027086599 7:75269394-75269416 GAGCAGAAGCAAATGCATGAAGG - Intergenic
1027213054 7:76165752-76165774 GAGGAGACGCAGGGGCAGGAAGG + Intergenic
1027595741 7:80171841-80171863 GAAGAAAAGCTGAGGGAGGAAGG - Intronic
1028078779 7:86548247-86548269 GAGGATGAGCTGAAGCAGGATGG - Intergenic
1028616388 7:92772618-92772640 GGGCAGTGGCTGAGCCAGGATGG - Intronic
1028739276 7:94253512-94253534 GGTCAGAAGGTGAGGTAGGAAGG - Intergenic
1029155489 7:98514518-98514540 CACCAGCAGCTGAGGCAGGAAGG + Intergenic
1029392899 7:100287397-100287419 GAGCAGAAGCAAATGCATGAAGG - Intergenic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1029730051 7:102433264-102433286 GGACAGGAGCTGGGGCAGGAGGG + Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030161411 7:106512175-106512197 GAGCAGAAGCTGAGACAGTCTGG - Intergenic
1030677468 7:112398937-112398959 GAGGAGAAGCTCAGGCTGGCTGG + Intergenic
1031619815 7:123922714-123922736 GAGCAACAGCAGAGGCAGGAAGG - Intergenic
1031819735 7:126485407-126485429 TAGCACAAGCTAAGGCATGAGGG + Intronic
1031894765 7:127336444-127336466 TAGCAGAAGCAGAGGCTGGAGGG - Intergenic
1031973045 7:128077499-128077521 GAGCAGATGAACAGGCAGGAGGG + Intronic
1032047318 7:128620978-128621000 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1032436000 7:131900810-131900832 GAACAGGGGCTGAGGAAGGAGGG + Intergenic
1032640627 7:133763201-133763223 AAGCAGAGGCTGTGGCAGGGGGG - Intronic
1033597292 7:142866849-142866871 GGGCAGAAGCAGGGGCAAGAGGG + Intronic
1033705206 7:143879870-143879892 CAGCAGAGGCTGAGGGAGAAGGG - Intronic
1033858741 7:145598489-145598511 GATGAGAGCCTGAGGCAGGAAGG + Intergenic
1034164238 7:149013432-149013454 TTCCAGAAGCTGAGGCGGGAGGG + Intronic
1034274551 7:149818330-149818352 GAGCTCAAGCTGAGGAAGGCTGG + Intergenic
1034274674 7:149818813-149818835 GATCAGAAGTTGAGGCTGGAAGG - Intergenic
1034410985 7:150942129-150942151 GAGCAGGAACAGAAGCAGGAGGG - Intergenic
1034712194 7:153203515-153203537 GGGCAGAAGCAGAGGGAGCAAGG + Intergenic
1034852107 7:154503078-154503100 GAGCAGAAACAGAGGAAGCAAGG - Intronic
1035127487 7:156619025-156619047 CAGCAGCAGCTGGGGAAGGAAGG + Intergenic
1035471728 7:159114277-159114299 GAGGAGAAGGGGAGGCAGGCAGG + Intronic
1036209230 8:6828558-6828580 GGGAGGAAGCTGAGGCGGGATGG + Intronic
1036708445 8:11061796-11061818 GGGCTGAAGAAGAGGCAGGAGGG + Intronic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1037070216 8:14636666-14636688 TATCAGAAGCTCAGGAAGGAAGG + Intronic
1037724501 8:21472315-21472337 GACCACAAGCAGAGGAAGGAAGG + Intergenic
1037747832 8:21661055-21661077 GAGCAGAAGGAGAGGCCGGTAGG - Intergenic
1037803258 8:22046344-22046366 GACCAGGAGGTGAGGCAGGGTGG - Intronic
1039754911 8:40512728-40512750 GAGAACAAGCTGAAGCAGGGTGG - Intergenic
1039910496 8:41823024-41823046 GAGCATGAGCGGAGGCAGAAGGG + Intronic
1040848141 8:51867797-51867819 TACCAGAGGCTGGGGCAGGAGGG + Intronic
1041181702 8:55256099-55256121 GAGCTGAGGCTGAGGAAGGCAGG + Intronic
1041256619 8:55984328-55984350 GGGCAGATGCTGAGCCAGCAGGG - Intronic
1041725140 8:61011156-61011178 TGGGGGAAGCTGAGGCAGGAGGG + Intergenic
1041893814 8:62901360-62901382 CATGGGAAGCTGAGGCAGGAGGG + Intronic
1041985431 8:63917129-63917151 GAGAAGTCACTGAGGCAGGAAGG - Intergenic
1042748754 8:72135391-72135413 GAGCAGAAGCCAAGGCATGCAGG - Intergenic
1043018287 8:74968761-74968783 GAGCATGAGCTTTGGCAGGAAGG + Intergenic
1043423364 8:80123204-80123226 GGCCAAAAGCAGAGGCAGGAGGG + Intronic
1043586772 8:81779180-81779202 GAGCAGTAGCTAAGGCAGGGAGG + Intergenic
1043930569 8:86086114-86086136 GAGCAGAAAGAGAGGGAGGAGGG + Intronic
1045088161 8:98710318-98710340 GAGCATGAGCTGAAGCAGGGCGG + Intronic
1045391393 8:101718536-101718558 ATGCAGACGCTGAGGCAGGGAGG - Intronic
1045430341 8:102107999-102108021 GACCAGGAGCAGGGGCAGGAAGG - Intronic
1045964419 8:108007830-108007852 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
1046439527 8:114239997-114240019 TTTGAGAAGCTGAGGCAGGAAGG + Intergenic
1046615320 8:116471160-116471182 GTGCATTAGCTGAGGCAGGGAGG + Intergenic
1046900745 8:119521145-119521167 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
1047691179 8:127356268-127356290 GTGTAAGAGCTGAGGCAGGAAGG + Intergenic
1047744106 8:127831208-127831230 ATACAGAGGCTGAGGCAGGAGGG + Intergenic
1048289108 8:133166215-133166237 GGGCAGGGGCTGATGCAGGAGGG + Intergenic
1048366598 8:133743867-133743889 GAGCACAACATGGGGCAGGAGGG + Intergenic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1048861448 8:138727175-138727197 GTGCTGGAGCTGAGGGAGGAGGG - Intronic
1049056377 8:140240483-140240505 CACCCGAAGTTGAGGCAGGAAGG - Intronic
1049062579 8:140287363-140287385 GAGACGAAGCAGAGGGAGGAGGG + Intronic
1049208416 8:141374198-141374220 GAGATGAAGCTGCTGCAGGAAGG - Intergenic
1049404307 8:142444906-142444928 GTGCAGATGTTGAGGAAGGATGG - Intergenic
1049579424 8:143404618-143404640 GAGGAGAGGCTGGGGCAGGCGGG + Intergenic
1049585319 8:143430198-143430220 GCGCAGAAGCTGGGCGAGGAGGG + Exonic
1049807457 8:144547451-144547473 GAGCGGAAGGTGAGGCCGAAGGG - Exonic
1049982805 9:920338-920360 GAGCAGCCTGTGAGGCAGGAGGG + Intronic
1051296993 9:15607296-15607318 GGGCTGAAGTTGTGGCAGGATGG - Intronic
1051814211 9:21086813-21086835 AAACAAAAGCTGAGGTAGGATGG + Intergenic
1051863472 9:21652146-21652168 GAGGAGGAGCTGAAGCAGGGTGG - Intergenic
1053248462 9:36554564-36554586 TTTCAGAGGCTGAGGCAGGAGGG - Intergenic
1053301044 9:36949805-36949827 GAGGAGATGCTGTGGTAGGATGG - Intronic
1054880711 9:70142000-70142022 GAGAAATAGCAGAGGCAGGAAGG - Intronic
1055752553 9:79522831-79522853 GAGCTGCAGCCGAGGCAGGCAGG + Intergenic
1055930087 9:81551196-81551218 GATAAGAAGCTGTGGTAGGATGG - Intergenic
1056077626 9:83058018-83058040 GAGGAGAAACTGAGGCAAGATGG + Intronic
1056815052 9:89795114-89795136 GAGCAGGAGCAGAGCCAGGACGG - Intergenic
1056844424 9:90025065-90025087 AAGCAGAAGCCGTGTCAGGAGGG + Intergenic
1057265001 9:93610961-93610983 GATCAGAAGATTGGGCAGGATGG + Intronic
1057266352 9:93620354-93620376 GGGCAGCAGGTGAGGCACGAGGG + Intronic
1057423570 9:94930651-94930673 GAAAAGAAGCTGAGGCAAGCAGG + Intronic
1058138493 9:101334071-101334093 GAGCAAAAGCTGAGTGATGATGG - Intergenic
1058572802 9:106365732-106365754 GTGCAGAAGCTGAGGAGGCAGGG - Intergenic
1058954360 9:109931736-109931758 GCAGAGTAGCTGAGGCAGGAGGG - Intronic
1058957707 9:109964375-109964397 AGGCAGAGGCAGAGGCAGGAAGG + Intronic
1060014312 9:120073348-120073370 AAGAGAAAGCTGAGGCAGGAAGG + Intergenic
1060338928 9:122755620-122755642 GAACAGAAGCTGAGACTGAAAGG + Intergenic
1060445754 9:123686127-123686149 GAGTAGAAGCTAATGCAGTAAGG + Intronic
1060916212 9:127392558-127392580 GGGCAGCAGCTGAGCCAGGTGGG + Intronic
1060928626 9:127473689-127473711 GAGCAGTGGCTGAGTCAGGGTGG + Intronic
1061399380 9:130360085-130360107 GGGCAGAGGCTGAGGCAGCCAGG - Intronic
1061845786 9:133387284-133387306 AAGCTGAAGGTGGGGCAGGAGGG + Intronic
1061877095 9:133549625-133549647 TATGAGAGGCTGAGGCAGGAGGG - Intronic
1061958844 9:133977823-133977845 GGGCAGCACCTGAGTCAGGAAGG + Intronic
1062077763 9:134601156-134601178 GCCCAGAAGCTGAGGGAGGTGGG - Intergenic
1062103750 9:134741591-134741613 GTACAGAAGCAGAGGCAGGAGGG + Intronic
1062173634 9:135148918-135148940 GGGCAGGAGCTGAGGAATGAAGG + Intergenic
1062750163 9:138246726-138246748 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1203780002 EBV:95990-96012 GAGCAGGAGGAGGGGCAGGAGGG + Intergenic
1203780026 EBV:96053-96075 GAGCAGGAGGAGGGGCAGGAGGG + Intergenic
1203780046 EBV:96107-96129 GAGCAGGAGGAGGGGCAGGAGGG + Intergenic
1203780056 EBV:96134-96156 GAGCAGGAGGAGGGGCAGGAGGG + Intergenic
1203780076 EBV:96188-96210 GAGCAGGAGGAGGGGCAGGAGGG + Intergenic
1203780086 EBV:96215-96237 GAGCAGGAGGAGGGGCAGGAGGG + Intergenic
1203780124 EBV:96317-96339 GAGCAGGAGGAGGGGCAGGAGGG + Intergenic
1203780180 EBV:96470-96492 GAGCAGGAGGAGGGGCAGGAGGG + Intergenic
1203780190 EBV:96497-96519 GAGCAGGAGGAGGGGCAGGAGGG + Intergenic
1203657743 Un_KI270753v1:14920-14942 GAACAGACGCTGAGGAAGGCGGG + Intergenic
1185595760 X:1305743-1305765 CAGGAGAAACTGAGGCAGGGTGG + Intronic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186437919 X:9559202-9559224 GAGACGAAGCTGAGACAGGAAGG - Intronic
1186713134 X:12221527-12221549 GAGCTGAAACAGAGGAAGGATGG + Intronic
1187521779 X:20020616-20020638 TAGCAGCAGCTGAGGCAGGAAGG - Intronic
1187615942 X:20993016-20993038 TTGCAGAAGCTGGGGAAGGAGGG + Intergenic
1188045864 X:25425949-25425971 GAGCATAAGCTGTGGTAGTATGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188527009 X:31097733-31097755 GAGCTGAAGAGGAGGCAGGACGG + Intronic
1190058595 X:47196542-47196564 GAGCAAATGTTGAGGTAGGAAGG + Intronic
1190103047 X:47537494-47537516 GAGAACAAGGTGGGGCAGGAAGG + Intergenic
1190390530 X:49926883-49926905 GAGCAGAAGCAGGGGCAGTAAGG + Intronic
1190918900 X:54831355-54831377 TACCAGAGGCTGAGGGAGGAGGG - Intergenic
1191731757 X:64343807-64343829 GTGAGGAAGCTGAGGCAGAAAGG + Intronic
1191947209 X:66547872-66547894 GAGCAGAAGCTCTGTGAGGAGGG + Intergenic
1192190291 X:68987140-68987162 GGGCAGCAGCAGAGGCAGGATGG - Intergenic
1192191886 X:68996078-68996100 GTGGAGAAGCTGGGGCAGGGCGG + Intergenic
1192497516 X:71626180-71626202 CAGAAGAATCTCAGGCAGGATGG + Intergenic
1192706043 X:73529291-73529313 GAGGAGCAGCTTAGGGAGGAGGG - Intergenic
1192895753 X:75441139-75441161 GCACAGAAGCTGTGGCAGGCAGG - Intronic
1192949176 X:75998100-75998122 GAGCATGAGCTGAAGCAGGGTGG - Intergenic
1193417407 X:81241183-81241205 TAGAGGAAGCTGAGGCAGCAGGG - Intronic
1193785976 X:85760338-85760360 GAGCATCAGCTGTGGCAGTATGG + Intergenic
1194040857 X:88940789-88940811 GAGCATTGCCTGAGGCAGGATGG + Intergenic
1195036554 X:100975379-100975401 GAGTGGGAGCTGAGGAAGGAGGG - Intronic
1195263619 X:103158927-103158949 GGGCAGAAGGTGGGGCAGAAGGG - Intergenic
1196016367 X:110944512-110944534 GAGCAGGAACTGGGGGAGGAAGG - Intronic
1196966751 X:121064787-121064809 GCACAGAAGCTGCGGCAGGTTGG - Intergenic
1197446050 X:126552937-126552959 GAGGAGTAGCTGAGGCCGGGCGG + Intergenic
1198592370 X:138198452-138198474 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
1198975023 X:142327049-142327071 GAGCAGCAGCAGTGGCAGCATGG + Intergenic
1199137110 X:144266309-144266331 GAGCAGGAGCAGTGGCAGCATGG - Intergenic
1199679057 X:150213097-150213119 TAGCAGAAGGTGTAGCAGGAAGG + Intergenic
1200103294 X:153699128-153699150 GAACAGAAGCTGATCCAGGAAGG + Intergenic
1200799327 Y:7371504-7371526 TTTAAGAAGCTGAGGCAGGAGGG - Intergenic
1200870008 Y:8087759-8087781 GAGCAAAAAGTTAGGCAGGAGGG + Intergenic