ID: 1064611064

View in Genome Browser
Species Human (GRCh38)
Location 10:17103130-17103152
Sequence CTGGGTTATCAAAACTGAAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064611064_1064611068 13 Left 1064611064 10:17103130-17103152 CCATTTCAGTTTTGATAACCCAG 0: 1
1: 0
2: 0
3: 13
4: 209
Right 1064611068 10:17103166-17103188 CATGAACATAACCAACATCCGGG 0: 1
1: 0
2: 0
3: 10
4: 143
1064611064_1064611067 12 Left 1064611064 10:17103130-17103152 CCATTTCAGTTTTGATAACCCAG 0: 1
1: 0
2: 0
3: 13
4: 209
Right 1064611067 10:17103165-17103187 TCATGAACATAACCAACATCCGG 0: 1
1: 0
2: 1
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064611064 Original CRISPR CTGGGTTATCAAAACTGAAA TGG (reversed) Exonic
900568660 1:3347677-3347699 CTGGGGTAGCAAAGCTGAATGGG + Intronic
902184289 1:14713515-14713537 TTTGGTTATCACAACTGAATGGG + Intronic
902185464 1:14721684-14721706 CTGGGTTTTCAAAACTAAGCAGG + Intronic
905088323 1:35404943-35404965 CAGGGTTCTCAAAGCTGGAAAGG - Intronic
905372734 1:37493498-37493520 CTGGTTTATCATAAGTAAAATGG - Exonic
906010726 1:42522640-42522662 TTGGGACATCAAAACTGAAAGGG - Intronic
906053375 1:42893606-42893628 GTGGCTTTTCAAACCTGAAAAGG + Intergenic
906570420 1:46833436-46833458 ATGGGTTAACAAATCTGATATGG - Intergenic
906810486 1:48822030-48822052 CTGGAGTAACAAAACTCAAAAGG + Intronic
906860752 1:49356638-49356660 CTTGGTTATCAAAAATAAGAAGG + Intronic
907714072 1:56911556-56911578 CTTGGTTTTCACAACTGGAAGGG + Intronic
908435726 1:64103941-64103963 TTTGGTTATCACAACTGGAAAGG + Intronic
908612783 1:65881084-65881106 CAGGGTTATGGAAACTGACAAGG - Intronic
908615174 1:65912401-65912423 CTGGTTTATGAAGACTCAAAGGG - Intronic
908681577 1:66667619-66667641 CTGGGTTATCATAAATTTAATGG - Intronic
908900299 1:68948874-68948896 CTGTTTTTTTAAAACTGAAAAGG - Intergenic
909206767 1:72768584-72768606 CTTGCTGTTCAAAACTGAAAAGG + Intergenic
909801159 1:79809262-79809284 CTGAGTTGCCAAATCTGAAATGG + Intergenic
909983175 1:82129621-82129643 CTGGATCATCACAACTTAAAAGG + Intergenic
910009729 1:82446540-82446562 CTGGAAAGTCAAAACTGAAAAGG - Intergenic
911712491 1:101090329-101090351 CTGGGGATTCAAAAATGAAAAGG - Intergenic
913042400 1:115040161-115040183 CAGGTTTATCAAAGATGAAAAGG - Intergenic
915807804 1:158872981-158873003 CTGGGTTATGGAAACTGAGAAGG + Intergenic
916291644 1:163173444-163173466 CTGGGAAGTCAAAACTCAAAAGG + Intronic
916572728 1:166041438-166041460 CAGAGTTATCAACACTGACATGG - Intergenic
918708295 1:187696127-187696149 CAGGGTTAGCAGATCTGAAAGGG - Intergenic
920289149 1:204904687-204904709 CTAGATTATCTAAACTGAAAGGG - Intronic
920325465 1:205159863-205159885 CTGGATTCTAAAAACTGATAAGG + Intronic
920766113 1:208835387-208835409 CTGGGTGAGCAACACTGAAAAGG + Intergenic
921703527 1:218293552-218293574 CTGGATTATAAAAATTGATAGGG + Intronic
921752092 1:218807404-218807426 CTGGGCTATAAGAATTGAAAAGG + Intergenic
923863052 1:237911656-237911678 CTGAATTATTAAACCTGAAAGGG - Intergenic
1063176182 10:3552772-3552794 CTGGGTCTTCAGAAGTGAAAGGG - Intergenic
1064611064 10:17103130-17103152 CTGGGTTATCAAAACTGAAATGG - Exonic
1065058189 10:21869142-21869164 CTGTCTTATCAGACCTGAAAAGG - Intronic
1070327423 10:75397538-75397560 CTGGCTTGTTAAAAGTGAAAGGG - Intergenic
1074234053 10:111566983-111567005 CTGGGTATTCAAAACAGAAGCGG + Intergenic
1074641826 10:115393116-115393138 CTGGATTACTAACACTGAAATGG + Intronic
1075541146 10:123315563-123315585 TGAGGTTGTCAAAACTGAAAAGG + Intergenic
1078360619 11:10664950-10664972 ATTGGTTCTCAAAACAGAAAAGG - Intronic
1085197452 11:74681167-74681189 CTGGGTTCACAAAGCTGAACTGG - Intergenic
1087013991 11:93538688-93538710 CTGGGGCATCAGACCTGAAATGG + Intronic
1087032711 11:93722007-93722029 CTGTGTTTTCATAACTTAAAAGG - Exonic
1087835309 11:102868307-102868329 TTTGGTTGTCAAAACTAAAAAGG - Intronic
1088065613 11:105715429-105715451 CTTGGTCATCAAAACAAAAAGGG - Intronic
1088384102 11:109233491-109233513 CTGGGTGATCAAAATTAACACGG - Intergenic
1088852341 11:113715155-113715177 CTGGGTAATGAAAATGGAAAGGG + Intergenic
1090144989 11:124311855-124311877 CTGAGTTTGCAAAACTGAACAGG - Intergenic
1091136769 11:133198309-133198331 CTGAGTTTTAAAAAGTGAAATGG + Intronic
1091657427 12:2355746-2355768 TTTGGTTTTCACAACTGAAAGGG + Intronic
1096792658 12:54054486-54054508 CTGGGTTAGCACAATTGAACTGG + Intronic
1097096406 12:56552320-56552342 CTTGGTTACCAAGACAGAAAAGG + Intronic
1097479646 12:60106305-60106327 CTGAGGTATAAAAACTGATATGG + Intergenic
1097499664 12:60387398-60387420 TTGGGTTAAAAAAACAGAAAAGG + Intergenic
1097748146 12:63322462-63322484 CTGGGTTATAAAACATTAAATGG + Intergenic
1098227464 12:68339590-68339612 CTAGCTTTTCAAAACAGAAAGGG - Intergenic
1099219826 12:79900142-79900164 CTGGCTTATCCAAACAGGAAAGG - Intronic
1101939634 12:109090323-109090345 CTGGGTATTCAAGATTGAAAGGG + Intronic
1102682738 12:114701702-114701724 CTGGGATCTCAAAACTGTGACGG + Intergenic
1104395377 12:128427955-128427977 CTGGGTAAGCACAGCTGAAAAGG - Intronic
1104548433 12:129733152-129733174 CTGAATTATCAAACCTGAAGGGG + Intronic
1105268215 13:18842240-18842262 CTGGGATATCAAAAAAGTAAAGG + Intergenic
1106741797 13:32652283-32652305 ATGGATTTTCAAAAGTGAAAAGG - Intronic
1109797840 13:67340406-67340428 CTGGGAAATCGAAACTTAAATGG - Intergenic
1111350947 13:87030623-87030645 GTGTGTTATAAAAACTCAAAAGG - Intergenic
1112196974 13:97235800-97235822 CTGGGTTCTCCAAACTGTAGCGG - Intronic
1112361177 13:98719924-98719946 CTGGGATTTCAAAGCTAAAATGG - Intronic
1114437686 14:22721565-22721587 CCTTGATATCAAAACTGAAAAGG + Intergenic
1114844678 14:26307238-26307260 CTGGGATAGCAATAGTGAAATGG + Intergenic
1115295504 14:31821163-31821185 CTGGGCTATCAAAGCAAAAATGG + Intronic
1115472263 14:33780076-33780098 CTGCGTTAGCAACACTGACATGG + Intronic
1117530053 14:56652081-56652103 GTGTGTGATTAAAACTGAAAGGG + Intronic
1120481176 14:85051729-85051751 CTGTGTTATCAAGACAGAGAGGG - Intergenic
1121524833 14:94612643-94612665 CTGGGTTTTCACACCTGCAAAGG + Intronic
1122183081 14:99970066-99970088 CAGAGTTGTCAAACCTGAAAGGG - Intergenic
1122740039 14:103867052-103867074 CTGGGTTTTCAAGACCAAAATGG - Intergenic
1125336534 15:38631961-38631983 CTTGGTTCTCACAACTGGAAAGG + Intergenic
1125387894 15:39157693-39157715 ATAAGTCATCAAAACTGAAATGG + Intergenic
1126286985 15:47024973-47024995 TTTAGTTATCAAAACAGAAATGG + Intergenic
1131361594 15:91796688-91796710 CTTGGTTCCCAAAACTGACAAGG + Intergenic
1131406322 15:92167809-92167831 ATGGGTTATCAAACCTAAAATGG + Intronic
1133183531 16:4077622-4077644 ATGAGATATAAAAACTGAAAAGG + Intronic
1133424487 16:5675920-5675942 CTGGGTTATGAAGACTCAATGGG + Intergenic
1136492792 16:30621377-30621399 ATGGGATATCAGAACGGAAAAGG - Intronic
1136690294 16:32023933-32023955 CTTGGCTAGAAAAACTGAAAAGG + Intergenic
1136790883 16:32967497-32967519 CTTGGCTAGAAAAACTGAAAAGG + Intergenic
1136878932 16:33886435-33886457 CTTGGCTAGAAAAACTGAAAAGG - Intergenic
1136986341 16:35108982-35109004 CTGGGTTTTCTAACCTCAAAGGG - Intergenic
1138111715 16:54329535-54329557 CAGGGTTCTCAGAACTGAACTGG - Intergenic
1140200559 16:72891331-72891353 CTGGGGTATCAGAACAGAAGAGG + Intronic
1141760452 16:86025693-86025715 CTGGGTTTTCAAAACTTAGAGGG - Intergenic
1141959424 16:87394512-87394534 CAGGGTTCTCAAAGTTGAAATGG + Intronic
1203093088 16_KI270728v1_random:1228954-1228976 CTTGGCTAGAAAAACTGAAAAGG + Intergenic
1145074487 17:19840431-19840453 TTGTGTTTTCAAAACTGACATGG + Intronic
1145958705 17:28872923-28872945 CTGGATTATCAAGACAGACAAGG + Intergenic
1146501417 17:33368193-33368215 CTAGGTCATAAAAAGTGAAATGG + Intronic
1146988931 17:37249736-37249758 CTGGTTTTTTAAAACTCAAATGG - Intronic
1147153151 17:38530068-38530090 CTTGGCTAGAAAAACTGAAAAGG + Exonic
1147284166 17:39387942-39387964 CTGTATTATAAAAACTAAAAAGG + Intronic
1147358466 17:39916146-39916168 CTTGGCTATCAAGACTGAAGGGG - Intronic
1149417083 17:56470647-56470669 CGGGGTTTTCAAAACAGATAGGG + Intronic
1153213760 18:2797545-2797567 CTGGGTGAATAAAACTGACATGG + Intronic
1153591373 18:6677003-6677025 TTGGGTTATTTTAACTGAAATGG - Intergenic
1153733349 18:8038314-8038336 CTGGGTTTTTAAAACTGCACAGG - Intronic
1154419807 18:14217791-14217813 CTGGGATATCAAAAAAGTAAAGG - Intergenic
1155245132 18:23901054-23901076 CTGGGTTATAAAAACTACAAAGG - Intronic
1160890262 19:1373963-1373985 CTGGCTTACCAAAACAGGAAAGG + Intronic
1162857003 19:13476408-13476430 ATAGGTGCTCAAAACTGAAATGG - Intronic
1164937598 19:32227503-32227525 CACGGTTAGGAAAACTGAAAAGG + Intergenic
926557329 2:14374443-14374465 CTGGGAGGTCAAGACTGAAATGG + Intergenic
926849396 2:17178298-17178320 ATGTGTTATCAGAACTCAAAAGG - Intergenic
927476047 2:23414905-23414927 CTGGGTAATTGAAACAGAAAAGG + Intronic
927502841 2:23593753-23593775 CTGAGATATCTAAACTGTAAGGG - Intronic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
930720061 2:54629883-54629905 CTAGGCTCTCAAATCTGAAATGG - Exonic
933380763 2:81541040-81541062 TTGCTATATCAAAACTGAAAAGG + Intergenic
935514185 2:104015225-104015247 GTGAGTAATCAAAACAGAAAAGG - Intergenic
935597389 2:104889926-104889948 CTGGCTTATCAGAACCCAAAGGG + Intergenic
937532477 2:122845825-122845847 TTTGGTTGTCACAACTGAAAGGG + Intergenic
939130571 2:138231200-138231222 CTGGGTTACCAAATCTTAATTGG - Intergenic
940022626 2:149171450-149171472 TTGAGTTATAAAAATTGAAAGGG - Intronic
941211517 2:162645924-162645946 CTGGCTTATCAACAGGGAAAAGG - Intronic
942954538 2:181758926-181758948 TTGGGATATCAAGACTGCAAGGG + Intergenic
943440308 2:187919328-187919350 CTGGGAAATCAAAACTTAAGTGG - Intergenic
943954045 2:194162988-194163010 CTGGGAAATCAAAACTTAAGTGG - Intergenic
944587774 2:201187778-201187800 CTCGCTTCCCAAAACTGAAATGG + Exonic
945384675 2:209182651-209182673 CTGGTTTATCATAAGTAAAATGG + Intergenic
945914346 2:215686979-215687001 CTGGGTTGTCATGACTGAAATGG - Intergenic
1169267517 20:4175673-4175695 CTGGGTTAGCAGAGATGAAAGGG + Intronic
1170657071 20:18297962-18297984 CTGGGTAAGGAAAACAGAAATGG - Intronic
1170902132 20:20474466-20474488 CTGTGTTGACAAAACTGCAAAGG + Intronic
1174449457 20:50610354-50610376 CTGGTTTTTCAACAATGAAATGG + Intronic
1176853487 21:13941508-13941530 CTGGGATATCAAAAAAGTAAAGG + Intergenic
1177824075 21:26063063-26063085 CTGGGTTAACAATTCTGATACGG + Intronic
1179360119 21:40698368-40698390 CTGGGAAATCAAAACTTAAGTGG + Intronic
1180237799 21:46474781-46474803 CTAGGTTTTCAGAATTGAAAAGG + Intronic
1181370635 22:22413298-22413320 CAGGGATATCCAAACTGATAAGG - Intergenic
1185319561 22:50194230-50194252 CTGGGTTCTGAGAACTGAACAGG - Intronic
949183455 3:1163058-1163080 TTGGGTAATCAGAACTGGAAAGG - Intronic
949455527 3:4234299-4234321 CTGATTTATCAAAAGTCAAAGGG + Intronic
949516717 3:4814143-4814165 CTGGGGTTTAAAACCTGAAAAGG + Intronic
949795141 3:7841748-7841770 ATGGCTTATTAAAGCTGAAAGGG + Intergenic
954903205 3:54037864-54037886 CTGTGATATCAAAAATGTAAGGG - Intergenic
955565386 3:60238905-60238927 CAGGATTATCATAATTGAAAAGG - Intronic
958895951 3:99829480-99829502 ATAGGTTATCAGAACTGGAAGGG + Intronic
962726476 3:138232931-138232953 CTGGGTTGTCAAAATTGATAAGG + Intronic
968256995 3:197284161-197284183 ACTGGTTATTAAAACTGAAAGGG - Intronic
970535954 4:17029980-17030002 CTGGGTAATTTAAAATGAAAAGG + Intergenic
971524121 4:27594429-27594451 CTGAGTTATGGAAACTGAGATGG - Intergenic
973702415 4:53550461-53550483 CTTTCTTATCAAAATTGAAAAGG - Intronic
975994296 4:80296647-80296669 CTGAGTTATGAGCACTGAAAAGG - Intronic
979511508 4:121559248-121559270 TTGGGTTATCAAAATAGCAAAGG - Intergenic
979921752 4:126504949-126504971 CTGGGTTAAAACAAATGAAAAGG + Intergenic
981740635 4:147997978-147998000 CAAGCATATCAAAACTGAAATGG + Intronic
982432239 4:155336279-155336301 CTGGGAAATCAAGACTGGAAAGG - Intergenic
982593426 4:157347035-157347057 CTGGGTTAACAATACAGGAAGGG + Intronic
984724091 4:183003351-183003373 CTGGGTCATCAGAAAGGAAAGGG + Intergenic
985470798 5:43952-43974 CTGTGTTATCATTAGTGAAAGGG - Intergenic
985470802 5:44039-44061 CTGTGTTATCATTAGTGAAAGGG - Intergenic
986607506 5:9536659-9536681 CTGGGTGATCTAAACTGGAAAGG - Intronic
990296444 5:54406164-54406186 CTGGTTTATCAAACCAGCAATGG + Intergenic
990724745 5:58741011-58741033 GTGGATTATCAAACCTAAAAGGG - Intronic
991184401 5:63790335-63790357 CTGGGTTTTCCAAGTTGAAATGG - Intergenic
991530042 5:67604963-67604985 GTGGTTTATTAAAAATGAAAAGG - Intergenic
992424054 5:76637494-76637516 CTGGGTTGTCAATATTTAAAAGG + Intronic
992484572 5:77181891-77181913 CTGGGTTATAAAATCCGAGAGGG - Intergenic
995199133 5:109407592-109407614 ATAAGTTATAAAAACTGAAAAGG + Intronic
997336259 5:133110862-133110884 CTGGGTTAGGAAAGTTGAAAGGG + Intergenic
998198200 5:140094753-140094775 CTGGGACATAAAAACTGAGATGG - Intergenic
1001567754 5:172711535-172711557 CTGGGTTATTAAAGCTGCAAGGG - Intergenic
1001690146 5:173626787-173626809 CTGGGTGATTTAAGCTGAAAGGG - Intergenic
1002132302 5:177089051-177089073 CTGGGTGGTCACAACTGACAAGG - Intronic
1002436534 5:179235065-179235087 CTGGGTTTTGAAGACTGAATAGG - Intronic
1002584782 5:180237597-180237619 AAGGGTTATCAACATTGAAAAGG + Intronic
1005201052 6:23344784-23344806 TTGTGTTTACAAAACTGAAAAGG + Intergenic
1005794685 6:29347528-29347550 CTGTTTTCTCAAAACAGAAAAGG - Intergenic
1006798964 6:36747525-36747547 CTGGGCTATCAGAGCTGGAAGGG - Intronic
1007668401 6:43530811-43530833 CTAGGATATGAAAACTGTAAAGG + Exonic
1007919879 6:45597179-45597201 CTGAGTTCTCTAAACAGAAACGG + Intronic
1009709013 6:67293369-67293391 CTTGGTTGTGAAAACTAAAAGGG - Intergenic
1010657779 6:78532429-78532451 TTTGGTTTTCAAAACTGGAAGGG - Intergenic
1010758591 6:79696056-79696078 CTGGGTAAACAAAGCTGTAAAGG - Intronic
1012694900 6:102366927-102366949 CTAGGTTATAAAAAGTGATATGG - Intergenic
1014046043 6:116888040-116888062 GTGGGTTAATAAAACTGATACGG + Intronic
1014126780 6:117785329-117785351 CTCTGTTATAAAAAATGAAAAGG - Intergenic
1019331103 7:461257-461279 CTGGGTTTTGAAGACTGAATAGG + Intergenic
1020144924 7:5634879-5634901 CTGGGGTAGCAAAACTGCCAGGG + Intronic
1021110966 7:16694290-16694312 CTGGGTTATTTATACAGAAAAGG + Intronic
1022591169 7:31664608-31664630 CTGGATTATCACATCTGAGATGG + Intergenic
1022708490 7:32829776-32829798 CAGGCTGATCATAACTGAAATGG - Intergenic
1022755564 7:33284779-33284801 GTGGTTTCTCAAAACTGATATGG - Intronic
1022914684 7:34935701-34935723 CAGGCTGATCATAACTGAAATGG + Intronic
1027438544 7:78193512-78193534 CTTGGTTATCAAAGCAGAAAAGG + Intronic
1029019832 7:97352777-97352799 CTTGGTTATCAAAACTTTGATGG - Intergenic
1029914653 7:104196214-104196236 CAGGGTGATCTACACTGAAAAGG + Intronic
1034503281 7:151465716-151465738 CTGTGTTGTCAAAATTTAAAAGG + Intergenic
1035706704 8:1681218-1681240 CTGTGTTATCAACACAGTAATGG - Intronic
1035768893 8:2130684-2130706 CTGGTTTATTCAAACTCAAATGG + Intronic
1038291634 8:26254703-26254725 GGGGGTTTTCAAAATTGAAAAGG + Intergenic
1040407701 8:47122913-47122935 CTGGGATATCAAAAATATAAAGG + Intergenic
1042737610 8:72005920-72005942 CTGGGAGATCAGAGCTGAAAAGG - Intronic
1046642199 8:116744512-116744534 TTGTTTCATCAAAACTGAAAGGG - Intronic
1047187712 8:122649304-122649326 CTTGGTTATCACAACTGGAGCGG - Intergenic
1047912591 8:129546504-129546526 CTGAGTTTTCAAAACTAAATAGG + Intergenic
1049447839 8:142639577-142639599 CTTGGTTTTCAATACTCAAACGG + Intergenic
1051520920 9:17987039-17987061 CATGGATATCAAAACTGCAAGGG - Intergenic
1052533567 9:29719358-29719380 CTGAGTTACCACAAGTGAAAGGG + Intergenic
1052810512 9:33054549-33054571 CTGGGTTCTATGAACTGAAAGGG + Intronic
1056179366 9:84066901-84066923 CTGTGATATGAAAATTGAAATGG + Intergenic
1061578726 9:131523862-131523884 CTGGGTTCTGACAACTGTAACGG - Exonic
1061686767 9:132286945-132286967 CTGGGGTTTCAAAGCTGAGATGG + Intronic
1062166372 9:135109671-135109693 GTGTGTGATCAAAACTGAATGGG - Intronic
1185812555 X:3124257-3124279 CTGGGTTGTCAAGACTTAGAAGG + Intergenic
1187338418 X:18400712-18400734 CTAGGTGATCACGACTGAAAGGG + Intergenic
1189662624 X:43318213-43318235 ATATGTTATCATAACTGAAAGGG - Intergenic
1189693594 X:43641325-43641347 CTGGGTTAAGAAAACTGACAAGG + Intergenic
1192192459 X:68999764-68999786 CTGGTTTTTCAGAACTGAGATGG - Intergenic
1192464427 X:71343956-71343978 CTGGCTTCTCAAAAGGGAAATGG + Intergenic
1192598148 X:72433208-72433230 CTTGGTTGTCAAAACTGGAGAGG + Intronic
1198395427 X:136214506-136214528 GTGGAGTCTCAAAACTGAAAAGG + Intronic
1198733264 X:139757266-139757288 CTTTGTTTTAAAAACTGAAATGG - Intronic
1199712438 X:150479399-150479421 CTGGCTTATGAAAGCTGAAGAGG + Intronic
1201268973 Y:12236007-12236029 CTGGGTTGTCAAGACTTAGAAGG - Intergenic