ID: 1064611638

View in Genome Browser
Species Human (GRCh38)
Location 10:17109428-17109450
Sequence CTGCTCTGATTTAGGAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064611638 Original CRISPR CTGCTCTGATTTAGGAAATA AGG (reversed) Intronic
904316114 1:29664888-29664910 ATGCTCTGAGTTGGGAAATCAGG - Intergenic
905642507 1:39600866-39600888 CCGCTTTGATGTGGGAAATAGGG - Intergenic
905698315 1:39992500-39992522 CTGCTAATATTTAGGAAATGAGG - Intergenic
906813436 1:48852573-48852595 ATTCTCTAATTTAGGAAAAAAGG - Intronic
907833830 1:58090633-58090655 GGGTTCAGATTTAGGAAATAAGG - Intronic
908040358 1:60106165-60106187 CTTCTCTGATTAATAAAATATGG + Intergenic
908508968 1:64835756-64835778 ATGATCTGATTTAGGAATGAAGG + Intronic
909789947 1:79663547-79663569 CTGTCCTGATTTAAGAAACATGG - Intergenic
910533451 1:88268207-88268229 GTGCTCTGGTTTAGGGATTAAGG + Intergenic
910583049 1:88849303-88849325 CTGCTCTGATATACCAAATGGGG + Intergenic
912175102 1:107144963-107144985 CTGTTCTTATTTAGGTGATACGG + Intronic
912702854 1:111891126-111891148 GGCCTCAGATTTAGGAAATAGGG - Intronic
913356940 1:117932273-117932295 CTGCTCTGATTTTGAAATGAAGG + Intronic
914260205 1:145992713-145992735 CTGCCCTGTGTTAGGAGATAGGG - Exonic
916509598 1:165460277-165460299 ATGCTCTCATCTATGAAATATGG + Intergenic
918498739 1:185170219-185170241 CTGCTCTGTTTTAGAATTTACGG - Intronic
920293630 1:204942053-204942075 CTGCTATGTTTTAGGTACTATGG + Intronic
921378420 1:214498813-214498835 TTGTTCTGATTTAAGAGATAGGG + Intronic
921629740 1:217418851-217418873 CTGTTCTGATTTAGAAATAAAGG - Intergenic
924939760 1:248804869-248804891 CTGCTGTGGTTTAGGGAAGAAGG - Intergenic
1063973517 10:11397598-11397620 CTGCTCTGATTTTGGGAAGCTGG - Intergenic
1064611638 10:17109428-17109450 CTGCTCTGATTTAGGAAATAAGG - Intronic
1066506759 10:36053424-36053446 CTGTTCTTATCTATGAAATAAGG - Intergenic
1068960008 10:62858315-62858337 CTATTCTGAATTAGGAAATGAGG - Intronic
1069959459 10:72071078-72071100 CTTCTATGATTCAGGAAAGAAGG + Intronic
1072245798 10:93542767-93542789 ATGTTCTGATTTAGGAGATTTGG - Intergenic
1074173727 10:110974320-110974342 TTGCTTTGATTTATAAAATAGGG + Intronic
1076131068 10:128014260-128014282 CTTCTCTGAGTTATAAAATATGG + Intronic
1076521235 10:131082596-131082618 CTGCTCTGAATGAGGGCATATGG + Intergenic
1079065922 11:17292515-17292537 AGTCTCTGATTTAGAAAATATGG + Intronic
1079722399 11:23834448-23834470 CTGCTGTGTCTTAGGGAATAGGG + Intergenic
1079728733 11:23913253-23913275 CTACTCTTATTTTGTAAATAAGG - Intergenic
1079958478 11:26893378-26893400 CTGCTCTTATTAAGGAGTTAAGG + Intergenic
1080219520 11:29884891-29884913 CTACTATGATTTAGTAAAAATGG + Intergenic
1082693696 11:56333531-56333553 CTGTTCTGACTCAGGAAGTAAGG - Intergenic
1082880054 11:58028250-58028272 CTGCTCTGACCTAGGAACCACGG - Intronic
1084666474 11:70579107-70579129 CTACTCTGATTTATTAAATTAGG + Intronic
1087166217 11:95006218-95006240 CTGCTTTCATTCAGAAAATATGG - Intergenic
1087746276 11:101951025-101951047 CTGTTCTGGTTTAGGCAGTAAGG - Intronic
1088319333 11:108539063-108539085 CTGTTCTCATTCAGGAAATCTGG - Exonic
1097295808 12:57961436-57961458 CTGCCCTGATTTTGGTATTAGGG - Intergenic
1098048589 12:66428519-66428541 CTTTTCTGATATAGGATATAGGG + Intronic
1098408163 12:70149588-70149610 TTGCTATGATTTAGGGAATGAGG - Intergenic
1099898684 12:88681046-88681068 CTGGTCTGATTTAGGATTTCTGG + Intergenic
1101778866 12:107817739-107817761 CTGCTGAGATTTGGGAAACAAGG - Intergenic
1102974144 12:117194121-117194143 CTGCTCTGTTTTTGGCAATGTGG + Intergenic
1105670093 13:22603802-22603824 CTGATCTGGTTTTGGAATTAGGG - Intergenic
1107257477 13:38445701-38445723 CTGCTCTGAGCTTTGAAATAGGG + Intergenic
1109423359 13:62142684-62142706 CAGCAATGATATAGGAAATAAGG - Intergenic
1110134612 13:72050516-72050538 CAGTTCTGATTCAGGAAATTCGG + Intergenic
1110254878 13:73422369-73422391 CTCCTCTGAATTAGGCAAGATGG - Intergenic
1112394951 13:99021014-99021036 CTGCCTTGATTTATGAAATATGG - Intronic
1112695369 13:101942307-101942329 CTGCTCTGTCTAAGGGAATAAGG - Intronic
1112877668 13:104065056-104065078 GTGTTGTGATTTAGAAAATATGG - Intergenic
1113712968 13:112482549-112482571 GTCTTATGATTTAGGAAATACGG - Intergenic
1115148057 14:30249751-30249773 CTTCTCTGGTTCATGAAATAAGG - Intergenic
1115493611 14:33982063-33982085 CTGCTCCCATTTGGCAAATATGG + Intronic
1118013487 14:61634480-61634502 CTGCTTTAATTTAGAAAATAAGG + Intronic
1121173856 14:91875766-91875788 CTGCTCTGAACTAGGAGACAGGG + Intronic
1121531286 14:94656032-94656054 TTGCTTTGATTAATGAAATATGG + Intergenic
1125109242 15:36011676-36011698 CTGTTCTGTCTTAGCAAATAGGG + Intergenic
1125265799 15:37879390-37879412 TTGCTCTGGTTTTGGGAATAAGG + Intergenic
1128286022 15:66437863-66437885 CTGCTCTCATTGAGGAAAGAAGG - Intronic
1131031023 15:89186068-89186090 CTGCTCTAATTTGGGAGAAAAGG - Intronic
1131687784 15:94789110-94789132 ATGATCTGATTTAGGCAAGATGG - Intergenic
1131692955 15:94846011-94846033 CTCCTCTGATCTATGAAATTCGG - Intergenic
1133585334 16:7189095-7189117 CTACACTGATTCAGGTAATAAGG + Intronic
1135867508 16:26117834-26117856 ATGCTCTGTTGTAGGTAATATGG + Intronic
1139022133 16:62762903-62762925 TTTCTCTGATTTAGGGACTATGG + Intergenic
1141309948 16:82903812-82903834 GTGCTCTTATTTACGAAACATGG - Intronic
1144644076 17:16957452-16957474 CTTCTCAGATTTGGGAAATTTGG - Intronic
1145059666 17:19724717-19724739 CTGCTCTGAGTTAGGACCTGCGG - Intergenic
1145916330 17:28576174-28576196 CTGCAGTGATGTAGGAAAGAGGG + Intronic
1147530484 17:41271695-41271717 CAGCTCTGATTTAGGCAACCAGG - Intergenic
1147615535 17:41825157-41825179 CTGCTCTGATTCAGGGGATGTGG - Intergenic
1148719342 17:49739690-49739712 CCTCTCAGATTTAGGAAATAGGG + Intronic
1149789043 17:59461402-59461424 CTGCTCTAAGTTAAGAAACACGG + Intergenic
1150206017 17:63408237-63408259 CTGATTAGATGTAGGAAATAAGG + Intronic
1150957042 17:69870539-69870561 CTGAGCTCATTTAGGAAATGAGG - Intergenic
1151865410 17:76798717-76798739 CTATTATGATTTAGAAAATAAGG + Intergenic
1152092980 17:78257191-78257213 CAGCTCTGATTTGGGAGAAAGGG - Intergenic
1153860101 18:9194033-9194055 GTTTTCTGATTTAAGAAATAGGG + Intronic
1154324802 18:13382175-13382197 CTACTTTGATTTTGGAAAAAAGG + Intronic
1156110638 18:33722136-33722158 CTGCTCTGTCTTAGGAAATAGGG - Intronic
1159752536 18:72320276-72320298 CTTCTGTGATTCTGGAAATACGG - Intergenic
1160544378 18:79643097-79643119 CTTCTCTCATCTAGAAAATAGGG + Intergenic
1164455620 19:28404184-28404206 CTGCTCTGGTTTAAGAAAATGGG - Intergenic
1165971078 19:39630283-39630305 CTCCACTGAATTAGGGAATAAGG + Intergenic
925780493 2:7377416-7377438 CAGCTCTGTTTTGGGAAATGAGG + Intergenic
925970579 2:9103943-9103965 ATGCACTAATTTAGAAAATAGGG + Intergenic
927220547 2:20704275-20704297 CTGTTCTGATTTAGGAGATTAGG - Intronic
928277863 2:29919567-29919589 CAGCACAGATTTGGGAAATATGG - Intronic
930658923 2:54034679-54034701 TTGATATGATTTAAGAAATATGG - Intronic
930914700 2:56672550-56672572 GTGCTCTGCTGTAGGAAGTAAGG + Intergenic
931482638 2:62657405-62657427 GTTCTCTGATATAGAAAATAGGG + Intergenic
936625682 2:114145802-114145824 CTGTTCAGACTTAAGAAATAAGG - Intergenic
936715426 2:115181664-115181686 CTGCTTTGACCAAGGAAATATGG - Intronic
937698677 2:124838841-124838863 CTAATCTCATTAAGGAAATAAGG - Intronic
942319353 2:174723046-174723068 CTGCTTAGACTTAGGAAAAATGG - Intergenic
942366624 2:175235072-175235094 CTGCTCTGGGTTCTGAAATAAGG + Intergenic
943119338 2:183714817-183714839 CTGCTCTGATTTAGGACCCAGGG + Intergenic
943740824 2:191406553-191406575 TTGCTCTGTCTTAGGGAATAAGG + Intronic
945169064 2:206977105-206977127 CTGCTCTGATTTGGGAAGGCTGG + Intergenic
946505259 2:220293559-220293581 CTGACCTGATTTAGTCAATAAGG + Intergenic
947344591 2:229177841-229177863 ATGCTCTGAGGTAGGAACTACGG + Intronic
1175450359 20:59060590-59060612 CTGCTATAACTTAGGAAATTGGG + Intergenic
1175950744 20:62581860-62581882 CTGCTCTTATTTAGAAATTTTGG + Intergenic
1177268161 21:18810516-18810538 ATGCTCAGATTTAGGAACAAAGG - Intergenic
1177389285 21:20445731-20445753 TTCCTTTGATTTTGGAAATAGGG - Intergenic
1179723079 21:43326451-43326473 CAGTGCTGCTTTAGGAAATATGG + Intergenic
1182136487 22:27908847-27908869 CTGGTTTGACTTAAGAAATAAGG - Intronic
949107140 3:213113-213135 CTGCTCTGTCTTATAAAATAGGG + Intronic
949739558 3:7215164-7215186 AAACTCTGATTTAGAAAATATGG + Intronic
950632424 3:14291620-14291642 CTGTTGTGTTTCAGGAAATAGGG - Intergenic
951641824 3:24844910-24844932 CTGCTTTGGTCTTGGAAATATGG + Intergenic
952277355 3:31890320-31890342 CTGCTGTGATTTAGGAAAGCTGG - Intronic
955986839 3:64582438-64582460 CTTCTCTGACTTAACAAATAGGG + Intronic
956612416 3:71137526-71137548 CTGTTCTGATTGTGGAAATCAGG + Intronic
957391368 3:79576376-79576398 CTGGTAAGATTTTGGAAATATGG - Intronic
959165311 3:102769625-102769647 TTGTTGTGTTTTAGGAAATATGG + Intergenic
960212019 3:114980960-114980982 TTTCTCTGCTTTAGTAAATAGGG + Intronic
960285241 3:115820922-115820944 CTGCCAGGATTTGGGAAATAAGG - Intronic
960956450 3:123034819-123034841 CTGCTCTCATCTGGGAAATGAGG + Intergenic
961032503 3:123618858-123618880 TTGCTATGATTTAGCAAAGAAGG + Intronic
962453830 3:135547050-135547072 CTTGTGTGATTTAGGAAAGATGG + Intergenic
963626200 3:147677082-147677104 CTACTGTGATTTAGCAAAGAAGG - Intergenic
964046483 3:152333963-152333985 CTGCTCCCATTTTGGAAACAAGG - Intronic
966666296 3:182475098-182475120 CTGCTTATATTAAGGAAATATGG - Intergenic
966706025 3:182914871-182914893 CTGCCCTGATTTTGAGAATATGG - Intronic
969898793 4:10329449-10329471 CAGCTCAGTTTCAGGAAATAGGG + Intergenic
969944900 4:10773318-10773340 CTGCTCTGTTTTGGGAAGGATGG + Intergenic
971595916 4:28528383-28528405 CTGTTATAATTTTGGAAATAAGG + Intergenic
972896878 4:43632939-43632961 ATGATCTGAGTTGGGAAATAGGG - Intergenic
973304414 4:48629293-48629315 CTGTTCTGTTTTAGGATAGAAGG - Intronic
974648302 4:64722420-64722442 TTGCTCTGTTTTAGAAATTATGG + Intergenic
976033686 4:80790248-80790270 CTGCTGTGAGCTAGGAAACATGG - Intronic
982952309 4:161715310-161715332 CTGCTTTGATTTCTGAACTATGG - Intronic
983066035 4:163211455-163211477 ATGTTCAGATTCAGGAAATACGG - Intergenic
983119648 4:163865920-163865942 CTGCCCTTATTAAGGTAATATGG + Intronic
983195803 4:164805235-164805257 TTGCTCTGATTTGGGAAGAAAGG + Intergenic
984158941 4:176227497-176227519 CTGCTTTTATTTAGGCAATCAGG - Intronic
987008273 5:13733544-13733566 TTATTCTGATTTAGGAAATTTGG + Intronic
987393845 5:17402468-17402490 CAGCCCTGATTCAGGAAACAGGG - Intergenic
988455479 5:31383610-31383632 CTGCTCTGAGTAAGCAAATGAGG - Intergenic
988834151 5:35014986-35015008 CTCCTCTAATTTAGGAATTGTGG + Intronic
990939958 5:61192040-61192062 CTGCTGTGTTTTGAGAAATATGG - Intergenic
991102783 5:62811776-62811798 CTGTTCTGTTTTAAGAATTATGG + Intergenic
991974284 5:72171131-72171153 CTGCTCAGAATAAGGAAAAAGGG + Intronic
993606362 5:89995023-89995045 CTGGTGTGATTGAGGCAATATGG + Intergenic
995564282 5:113417358-113417380 CAGCTCTGCTTTATGAAGTATGG - Intronic
996329136 5:122311144-122311166 CTGATTTCATTTCGGAAATAAGG + Intergenic
998087447 5:139338093-139338115 CTGCACTGATCTAGGCACTAAGG - Intergenic
999356959 5:150944323-150944345 CTGCTTTGGTTTAGGAAATAAGG - Intergenic
1001031860 5:168269070-168269092 CGGCTCAGATTTGGGAAATGAGG + Intergenic
1002857276 6:1049397-1049419 CTGCTCTGTCTTAGGACCTAGGG + Intergenic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003540837 6:7016771-7016793 CTGCTCTGAGTGCTGAAATACGG + Intergenic
1003797506 6:9621392-9621414 CTTCACTGAATTAAGAAATAGGG - Intronic
1008161464 6:48081321-48081343 CTGCTCTGTTTTAGGAATAATGG + Intergenic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1009609030 6:65913906-65913928 GAGCCCTGATTTAAGAAATATGG + Intergenic
1010616005 6:78013162-78013184 CTGATCTGAGTTTGGAAACATGG - Intergenic
1010895730 6:81360469-81360491 ATTCTCTGTTTTAGGGAATAAGG + Intergenic
1013763295 6:113543578-113543600 ATGCACTGATTTAAAAAATAAGG - Intergenic
1014489798 6:122047811-122047833 TTGCTGTCATTTCGGAAATATGG - Intergenic
1014756117 6:125303177-125303199 CTGCTGAGATACAGGAAATAAGG - Intergenic
1014966837 6:127764570-127764592 CTGCATTATTTTAGGAAATAAGG - Intronic
1015300206 6:131644401-131644423 CTGCCCTGGTTTAAGACATAAGG - Intronic
1016389975 6:143565217-143565239 CTGCTCAGATACAGAAAATAAGG + Intronic
1017849453 6:158292072-158292094 CTGTCCCAATTTAGGAAATAAGG - Intronic
1021548400 7:21842387-21842409 CTGCTGTACTTTAGGAAATTTGG + Intronic
1024923822 7:54591260-54591282 CTATTCTGATTTAGGAAATAAGG + Intergenic
1028348005 7:89807599-89807621 CTGCTCTGGTGCAGGAAACAGGG + Intergenic
1028646128 7:93098679-93098701 CTGCTGGCATTGAGGAAATAAGG + Intergenic
1028889328 7:95969396-95969418 CTGAGCTAATCTAGGAAATAGGG + Intronic
1029798660 7:102923129-102923151 ATTCTTTGATTTAGGAAAGAAGG - Intronic
1030595790 7:111537468-111537490 CTGCTTAGATTTAGCATATAAGG + Intronic
1033393097 7:140947689-140947711 CTGCTATAATTTAAGAAATCTGG + Intergenic
1033674736 7:143529181-143529203 CTGCTTTAATTTAAGGAATAAGG - Intergenic
1033697100 7:143800258-143800280 CTGCTTTAATTTAAGGAATAAGG + Intergenic
1034183478 7:149156534-149156556 CTGATGGGAATTAGGAAATAAGG + Intronic
1035831571 8:2700234-2700256 TTCCTCTGATTTAGCAAACACGG + Intergenic
1039250300 8:35656560-35656582 ATGCTCTGATTTGAGAATTAAGG - Intronic
1039856234 8:41416780-41416802 CTGCTTTGTTTTTGGAGATAGGG + Intergenic
1041854820 8:62439231-62439253 GTCCTCTGGATTAGGAAATAAGG + Intronic
1044347776 8:91126179-91126201 CTGCTCTGGTCAGGGAAATAGGG - Intronic
1045906366 8:107350169-107350191 TTGCTGTCATTTAGGAAACATGG - Intronic
1045944615 8:107781555-107781577 TTTCTCTGATTTTGAAAATATGG - Intergenic
1047696576 8:127409345-127409367 CGACTCTGAGTTAGGAAATAAGG + Intergenic
1047790784 8:128201462-128201484 TTGCTTTCATTTTGGAAATAAGG + Intergenic
1047889775 8:129294847-129294869 CTGCTCTGACTCAGGAAACCTGG - Intergenic
1048525614 8:135199712-135199734 CTGCTCTTCTTTAGGAAATTAGG - Intergenic
1048567049 8:135612099-135612121 CTTCTCTGAATTTGGAAATGAGG - Intronic
1051065048 9:13092988-13093010 ATGCTCTGTCTTTGGAAATAAGG + Intergenic
1051504394 9:17811718-17811740 TTGGTCTGGTTTAGGAAATAAGG + Intergenic
1052577992 9:30314372-30314394 TTGCTCTGGGTTTGGAAATATGG + Intergenic
1053143970 9:35699508-35699530 CTACCCTGATCTATGAAATAGGG + Intronic
1053348069 9:37392684-37392706 CTTCTATGAGTTAGGAAAGATGG - Intergenic
1056031794 9:82560936-82560958 GAGCTCTGATTCAGGAAGTAGGG + Intergenic
1057157691 9:92858097-92858119 CTTCTCTGATTTTGGATATGTGG - Intronic
1060046569 9:120346254-120346276 CATCTCTGATGTAGGGAATATGG + Intergenic
1062646104 9:137549132-137549154 GTGTTCTGGTTTAGGAAATAAGG + Intronic
1186235030 X:7498501-7498523 CTGCTCTCATTTTGGAAAGAAGG + Intergenic
1188997943 X:36908725-36908747 ATGCTCTGTGTTAGGACATATGG + Intergenic
1189260859 X:39678010-39678032 TTGCTCTGGTTTAGGAAAGATGG - Intergenic
1190281964 X:48937012-48937034 CTACTCTGAGATAGAAAATAGGG + Intronic
1193151145 X:78125677-78125699 CAGCTCTTTTTTAGGATATATGG - Intronic
1193843849 X:86443972-86443994 CTTCTCTGATTTTGGTATTATGG + Intronic
1194770166 X:97893590-97893612 CTTTTCTGATTTCGGAATTAGGG + Intergenic
1195884768 X:109626332-109626354 CTGCTCTCATTTGGCAACTATGG - Intronic
1196676069 X:118421149-118421171 CTGCTTTGCTTTAGGGAAAAGGG + Intronic
1199303286 X:146237771-146237793 CAGCTCTGATTTTACAAATAAGG + Intergenic
1199895812 X:152127246-152127268 ATGCTCTGATTGAAGAAAAAGGG - Intergenic
1200322878 X:155208035-155208057 CCTCACTGATTGAGGAAATATGG - Intronic