ID: 1064611889

View in Genome Browser
Species Human (GRCh38)
Location 10:17112317-17112339
Sequence CCTCTGTGTGATAAGATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064611886_1064611889 -4 Left 1064611886 10:17112298-17112320 CCCAAATGTTCATCATGGTCCTC 0: 1
1: 0
2: 3
3: 14
4: 213
Right 1064611889 10:17112317-17112339 CCTCTGTGTGATAAGATCAAAGG No data
1064611887_1064611889 -5 Left 1064611887 10:17112299-17112321 CCAAATGTTCATCATGGTCCTCT 0: 1
1: 0
2: 2
3: 12
4: 200
Right 1064611889 10:17112317-17112339 CCTCTGTGTGATAAGATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064611889 Original CRISPR CCTCTGTGTGATAAGATCAA AGG Intronic
No off target data available for this crispr