ID: 1064612981

View in Genome Browser
Species Human (GRCh38)
Location 10:17123129-17123151
Sequence GATTCTATTATGTTTAGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 298}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064612981_1064612982 -8 Left 1064612981 10:17123129-17123151 CCTTATCTAAACATAATAGAATC 0: 1
1: 0
2: 0
3: 18
4: 298
Right 1064612982 10:17123144-17123166 ATAGAATCCTCAGTTCACAGTGG No data
1064612981_1064612985 5 Left 1064612981 10:17123129-17123151 CCTTATCTAAACATAATAGAATC 0: 1
1: 0
2: 0
3: 18
4: 298
Right 1064612985 10:17123157-17123179 TTCACAGTGGTGCTACATCTGGG No data
1064612981_1064612984 4 Left 1064612981 10:17123129-17123151 CCTTATCTAAACATAATAGAATC 0: 1
1: 0
2: 0
3: 18
4: 298
Right 1064612984 10:17123156-17123178 GTTCACAGTGGTGCTACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064612981 Original CRISPR GATTCTATTATGTTTAGATA AGG (reversed) Intronic
900743709 1:4345862-4345884 GATCCAATTAAGTTAAGATAAGG - Intergenic
908074373 1:60497946-60497968 GATTGTAATGTGTTTTGATATGG - Intergenic
908223727 1:62035198-62035220 GACACTATTATGTTAAGAGATGG - Intronic
908971934 1:69846297-69846319 GATAATATTATGGTTAGCTAAGG + Intronic
909941744 1:81619114-81619136 GATTATATTCTCTTTAGACATGG - Intronic
911229374 1:95344573-95344595 GAAACAATTAGGTTTAGATAGGG + Intergenic
911395531 1:97303081-97303103 GATTATGTTTTGTTTAAATACGG - Intronic
911887502 1:103322854-103322876 GCTTTTATTATGTTGAGGTATGG + Intergenic
912444057 1:109720868-109720890 GATTCTATTCTGTTAATAGAAGG - Intronic
913025975 1:114840867-114840889 GAAGTAATTATGTTTAGATAAGG - Intergenic
914738272 1:150439131-150439153 TGTTCTATAATGTTTAGATACGG - Intronic
916369129 1:164069630-164069652 GCTTTTATTATGTTGAGGTATGG + Intergenic
918976753 1:191498116-191498138 TATTTTATTATATTTACATAGGG + Intergenic
919378172 1:196819422-196819444 GATGCTGTTATGTTAAGATGAGG + Intergenic
919387867 1:196943458-196943480 GATGCTGTTATGTTAAGATGAGG + Intronic
920067822 1:203281604-203281626 TATTTTATTATGTGTAGAGACGG - Intergenic
920928540 1:210365620-210365642 CATTTTATTTTGTTGAGATAGGG + Intronic
921140995 1:212306154-212306176 CATTGTATTTTTTTTAGATAGGG + Intronic
923060524 1:230468411-230468433 GATTTTATCATGATTAGACATGG + Intergenic
1063359745 10:5442460-5442482 GTTTCTCTTATGTATAGAAAAGG - Intronic
1063818385 10:9805179-9805201 AAGTCTGTTATTTTTAGATAAGG - Intergenic
1064184162 10:13146385-13146407 GAGTTAATTATGTTTAGGTAAGG + Intergenic
1064612981 10:17123129-17123151 GATTCTATTATGTTTAGATAAGG - Intronic
1068168495 10:53361878-53361900 GAATCTATTATCTTTGTATATGG - Intergenic
1070572891 10:77654464-77654486 GAGTCTTTAATGTATAGATATGG - Intergenic
1070708728 10:78661197-78661219 GACTCTATTGTGTATAGATTTGG - Intergenic
1071217036 10:83417890-83417912 TATTTTATTATGTTCAGAAAAGG + Intergenic
1071322154 10:84473294-84473316 GATTCTAATGTGTTTACAGAGGG - Intronic
1073857290 10:107692334-107692356 GATTCTGGTATGTTCAGATCTGG + Intergenic
1074093534 10:110286567-110286589 TTTTATTTTATGTTTAGATAGGG + Exonic
1076430290 10:130397277-130397299 GATTGTTTTAAGTTAAGATAAGG - Intergenic
1079018673 11:16891083-16891105 TATTCTATTCTTTTTAGAGATGG + Intronic
1080589962 11:33714345-33714367 TATTTTTCTATGTTTAGATATGG - Intronic
1081224925 11:40509270-40509292 GATTCCATTTTGTTAAGAAATGG + Intronic
1085959932 11:81449747-81449769 GAGTCAATTAGGTTTAGATGAGG + Intergenic
1086209375 11:84300128-84300150 TATTTTAGTATGTTTACATAGGG - Intronic
1088397025 11:109380156-109380178 GATTTTATTATGTCTAAAGAAGG - Intergenic
1088722222 11:112604174-112604196 GATTCTTTTTTGTTTCCATAGGG + Intergenic
1088925999 11:114303721-114303743 TATTCTATTTTTTTTAGACAGGG + Intronic
1090170386 11:124597380-124597402 GATTTTGTGATGTTAAGATATGG - Intergenic
1092292857 12:7174201-7174223 GGTTTTATTATTTTTAGGTATGG - Intergenic
1092324929 12:7520766-7520788 GCTTTCATTATGTTGAGATATGG + Intergenic
1093142025 12:15519421-15519443 GATTCTCTTTTGTTTTGAGAGGG + Intronic
1093733445 12:22591949-22591971 AAATCAATTATGTTTAGAAATGG + Intergenic
1094718504 12:33036184-33036206 GAGTCTCTTATGTTAAGATAAGG - Intergenic
1096048248 12:48583350-48583372 TATTCTATTTTGTTTCTATATGG - Intergenic
1097527504 12:60756038-60756060 GATTGTATTAAGTTTAGTTCTGG + Intergenic
1098110976 12:67121564-67121586 GAATCCATTATGATTAGATGTGG - Intergenic
1098585411 12:72148045-72148067 GATTCTTTAAAGTTTAAATAAGG - Intronic
1098690755 12:73484520-73484542 GATTCAATTATGTCTTGGTATGG + Intergenic
1098853116 12:75621261-75621283 GATTCTATTCTGTTTCCAAATGG - Intergenic
1099035946 12:77587976-77587998 GGTTCTATTATTTTTAAATCAGG + Intergenic
1099399802 12:82189214-82189236 GCTACTATTATTTTTAAATAGGG - Intergenic
1102130264 12:110522513-110522535 GATTTTCTTATTTTTTGATAGGG + Intronic
1107848746 13:44548721-44548743 CATTTTAACATGTTTAGATATGG - Intronic
1112531659 13:100209956-100209978 TATTTTATTATTTTTAGAGATGG + Intronic
1112642318 13:101289872-101289894 GATGCTTTTATGTGTAGAGAAGG - Intronic
1112808720 13:103192114-103192136 GATTTTATTGTGTTTTGTTATGG + Intergenic
1112949386 13:104973763-104973785 GATTCTGTTATGTTAATATTGGG - Intergenic
1113321539 13:109237024-109237046 AATTCTATGGTCTTTAGATAAGG - Intergenic
1113657707 13:112079186-112079208 GGTCCTATTATATTAAGATAAGG + Intergenic
1114363513 14:22002436-22002458 GATTCTAATATGATGTGATAAGG + Intergenic
1114893222 14:26952133-26952155 GATTCTATTTTGTACACATATGG - Intergenic
1115423898 14:33231568-33231590 AATTCTATGATTTTTAGAAACGG - Intronic
1116788167 14:49310633-49310655 GATTCTTTTAGGTGTAGGTAAGG - Intergenic
1117678197 14:58176585-58176607 CATTCTATTATGTTTTAATAGGG + Intronic
1119044225 14:71303509-71303531 GATTTTTTTCTTTTTAGATATGG - Intergenic
1119446502 14:74668882-74668904 GGTTTTATTATTTTGAGATAGGG + Intronic
1120244793 14:81994348-81994370 AATTTTATTATGTTTTGAGATGG + Intergenic
1121698396 14:95931804-95931826 GAGTTAATTAGGTTTAGATAAGG + Intergenic
1121864825 14:97353024-97353046 GATTCTGATATTTTTAGAAATGG + Intergenic
1124631066 15:31337539-31337561 CATTCTATGATGTTCACATAAGG - Intronic
1125120166 15:36147103-36147125 GATTATATTATGTCTTGATGTGG - Intergenic
1125865389 15:43042920-43042942 GATTTTATTATATTTAAATTTGG + Intronic
1128310179 15:66625962-66625984 TATTCTATTAGGTTAAGAAAAGG + Intronic
1130308985 15:82736157-82736179 GATTCTTTTGTATTGAGATAGGG - Intergenic
1131574984 15:93579745-93579767 GATTATTTTATGGTTAGAGATGG - Intergenic
1133072842 16:3257827-3257849 AATTTTTTTATTTTTAGATAGGG + Intergenic
1134101472 16:11455360-11455382 GATTATATTATTTTTAAATATGG + Intronic
1135798833 16:25473681-25473703 GATTCTAGTGTGTGTAGATGTGG - Intergenic
1138736530 16:59257542-59257564 GGTTCCATTAGGTTTAGTTATGG - Intergenic
1138843294 16:60535449-60535471 GTTTTTATTATTTTGAGATATGG + Intergenic
1144366292 17:14547940-14547962 AATTCTGTTTTGTTTAAATAAGG - Intergenic
1146441123 17:32896086-32896108 GTTTTTATTTTTTTTAGATAGGG + Intergenic
1148171966 17:45528941-45528963 GATTACAGTATGTTTAGATGTGG - Intergenic
1148277403 17:46317447-46317469 GATTACAGTATGTTTAGATGTGG + Intronic
1148299610 17:46535312-46535334 GATTACAGTATGTTTAGATGTGG + Intronic
1148364052 17:47039623-47039645 GATTACAGTATGTTTAGATGTGG + Intronic
1149653398 17:58293827-58293849 GATTTTTTTTTTTTTAGATAGGG + Intergenic
1150402898 17:64873975-64873997 GATTACAGTATGTTTAGATGTGG - Intronic
1151055111 17:71021774-71021796 CATTCTAATATGTTGAGATTTGG - Intergenic
1203168927 17_GL000205v2_random:128751-128773 TATTGTGTTATGATTAGATAGGG + Intergenic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1155611625 18:27673764-27673786 GAATCTTTTATGTCTAGCTAAGG - Intergenic
1156125433 18:33899285-33899307 GCTCCTATTATGTTAAGATCAGG - Intronic
1159414644 18:68128709-68128731 GATTCAAATATGTTTATATGTGG - Intergenic
1159520867 18:69521146-69521168 AATTCTATAATGTTTATAGATGG - Intronic
1161914083 19:7215918-7215940 GATTCGAATATGTTCAGAGAAGG - Intronic
1162983363 19:14253666-14253688 TATTCTTTTATTTTGAGATAGGG - Intergenic
1163708186 19:18829344-18829366 CACTCTATTATATATAGATAGGG - Intergenic
1163971923 19:20806664-20806686 GATTATTTTATGTTTAGTAAGGG - Exonic
1163971939 19:20806832-20806854 AATTCTCTTATGTTTAGAAAGGG - Exonic
1163985766 19:20949161-20949183 AATTCTCTTATGTTTAGTAAGGG - Exonic
1163996838 19:21057552-21057574 AATTCTTTTATGTTTAGTAAGGG - Exonic
1164009196 19:21183460-21183482 AATTCTTTTATGTTTAGTAAGGG - Exonic
1164012826 19:21222388-21222410 AATTCTTTTATGTTTAGTAAGGG + Intronic
1164029067 19:21384373-21384395 AATTCTCTTATGTTTAGTAAGGG - Intergenic
1164032893 19:21425227-21425249 AATTCTCTTATGTTTAGTAAGGG - Exonic
1164067204 19:21727046-21727068 AATTCTCTTATGTTTAGTGAGGG + Exonic
1164075090 19:21808696-21808718 AATTCTGTTATGTTTAGTAAGGG + Exonic
1164141598 19:22472299-22472321 AATTCTCTTATGTTTAGGAAGGG - Intronic
1164223791 19:23223588-23223610 AATTCTCTTATGTTGAGAAAGGG + Exonic
1164238511 19:23361026-23361048 AATTCTCTTATGTTTAGCAAGGG + Exonic
1164238574 19:23361950-23361972 AATTCTCTTATGTTTAGCAAGGG + Exonic
1164238581 19:23362034-23362056 AATTCTCTTATGTTTAGCAAGGG + Exonic
1164252472 19:23492839-23492861 CATTCTCTTATGTTTAGTTAGGG + Intergenic
1164287561 19:23833180-23833202 AATTTTCTTATGTTTAGTTAGGG - Intergenic
1164298036 19:23933264-23933286 AATCCTCTTATGTTTAGTTAGGG - Exonic
1164298070 19:23933684-23933706 AATCCTCTTATGTTTAGATAGGG - Exonic
1164319334 19:24127343-24127365 AATTCTCTTATGTTTAGTAAGGG - Exonic
1164319379 19:24127847-24127869 AATTCTCTTATGTTTAGTTAGGG - Exonic
1164812688 19:31170368-31170390 GAGGCGATTAGGTTTAGATAAGG - Intergenic
1165120978 19:33558321-33558343 GGTTCTGTTCTGTTTAGAGATGG - Intergenic
1166899481 19:46048262-46048284 GCTTCTATTATTTTGAGGTACGG - Intronic
1167229997 19:48276526-48276548 GATTTTTTTTTGTTGAGATAGGG + Intronic
925606432 2:5665431-5665453 GATTCTCTAAGGTTTAGAAAGGG + Intergenic
925689336 2:6505310-6505332 AATTTTATTATTTTTAGAGATGG - Intergenic
927364803 2:22282022-22282044 GAAACTACGATGTTTAGATATGG + Intergenic
927732951 2:25491528-25491550 TAATCTATTATATTTAGATGTGG + Intronic
928061145 2:28114694-28114716 GATCCGATTATGGTTAGACATGG + Intronic
929043572 2:37769985-37770007 GTTTCTATCATGTTTAGAGGAGG + Intergenic
930371705 2:50509889-50509911 GATATGATTAGGTTTAGATAAGG + Intronic
930795807 2:55389599-55389621 GATTCTAATCTGTTTAGGGAAGG - Intronic
931310563 2:61075638-61075660 GCTTAAATTATGTTTAAATATGG + Intronic
932920722 2:75911696-75911718 GCTTTTATTATGTTGAGGTATGG + Intergenic
933058972 2:77711408-77711430 CATTCTGTTATTTTTAGGTATGG - Intergenic
933522032 2:83386390-83386412 GATTTTATTTTATTCAGATATGG + Intergenic
935494553 2:103763570-103763592 GATTCTATTTTTTTGAGACAGGG - Intergenic
935662430 2:105478682-105478704 GACTCTATCATGGTTAGAAATGG - Intergenic
935976221 2:108581624-108581646 GATGTTATTATGTTTAGAAGAGG + Intronic
936787079 2:116106351-116106373 CATTCTATTATGTAAAGCTAAGG + Intergenic
937483585 2:122290148-122290170 GTTTATATAATGTTTAGAAATGG - Intergenic
939540794 2:143491412-143491434 GATGCTATTATTTTGACATAAGG - Intronic
940070562 2:149682926-149682948 TATTTTATTATTCTTAGATATGG + Intergenic
941148330 2:161882043-161882065 GATTCTATGATCCTTAGAGAAGG - Intronic
942122185 2:172788885-172788907 TATTTTATTTTATTTAGATAGGG - Intronic
942324433 2:174764141-174764163 GTTTCTATTTTAATTAGATAAGG + Intronic
942362459 2:175186696-175186718 GATTCTCTTATGATTAGGAATGG + Intergenic
942622159 2:177856987-177857009 GATTATAATATGTCTAGATGTGG - Intronic
942937133 2:181571331-181571353 TATTGTTTTATGTTTAAATATGG + Intronic
943098739 2:183460761-183460783 TATTCTAGTATGTTTGGATGGGG + Intergenic
943302957 2:186226224-186226246 TATTCCATTGTGATTAGATAAGG - Intergenic
944371729 2:198991916-198991938 GAATCTATTATTTTTAGCAAAGG - Intergenic
944701727 2:202251903-202251925 GAGACTATTTTGTTTAGATGAGG - Intergenic
945773706 2:214078380-214078402 TATTTTATTATTTGTAGATATGG - Intronic
1168880350 20:1201278-1201300 TATTTTATTTTGTTTAGATAAGG + Intergenic
1171024566 20:21617288-21617310 AATTATATTATGCTTAGGTAAGG - Intergenic
1173126478 20:40340881-40340903 GATTTTATTATATTTTAATAAGG - Intergenic
1173765771 20:45608186-45608208 GATGCTATTAATTTTAGAAATGG - Intronic
1176402827 21:6330403-6330425 TATTGTGTTATGATTAGATAGGG - Intergenic
1176434330 21:6658701-6658723 TATTGTGTTATGATTAGATAGGG + Intergenic
1176458592 21:6985771-6985793 TATTGTGTTATGATTAGATAGGG + Intergenic
1176939568 21:14908010-14908032 TATTCTATTATGGTCAGAGAAGG + Intergenic
1177878154 21:26660078-26660100 AATTCTATCAGGTTTACATAAGG + Intergenic
1177886210 21:26748927-26748949 GATTCTAGGATGTATAGTTATGG + Intergenic
1182949354 22:34357504-34357526 TATTCTTTTATTTTTAGTTATGG - Intergenic
1184456667 22:44614786-44614808 GATGTGATTAGGTTTAGATAAGG + Intergenic
1203295722 22_KI270736v1_random:41426-41448 GTTTCTATTTTGTTTAGAGGAGG + Intergenic
949202661 3:1397783-1397805 GCTTCCTTTATGTTTAAATATGG - Intronic
951565334 3:24007297-24007319 TATTTTATTATTTTTAGACAGGG - Intergenic
952423328 3:33150555-33150577 TATTCTATTATGTTTTGCTTTGG + Exonic
952623599 3:35376472-35376494 AATTTTATTATATTTAGAGAGGG + Intergenic
952643554 3:35627629-35627651 GACTCTATTATGTGGAGTTATGG + Intergenic
952787662 3:37171680-37171702 TATTTTATTATGTATAGATTAGG + Intronic
953427870 3:42810597-42810619 CATTCGATTTTTTTTAGATAGGG - Intronic
954896345 3:53978500-53978522 ATTATTATTATGTTTAGATAGGG + Intergenic
956705557 3:71996064-71996086 GATTGTATTATCTTTATGTAAGG + Intergenic
956987210 3:74714849-74714871 TTTTCTATTATGTTTTGAGACGG - Intergenic
957282041 3:78163763-78163785 GATTCTCTTATGCTCATATAAGG - Intergenic
957885596 3:86282869-86282891 GAATCTTTTATGTCTAGCTAAGG + Intergenic
959563212 3:107806288-107806310 GATTCTTTTATTTTTACATAGGG + Intronic
962185207 3:133251364-133251386 GGTTATAATATGTTAAGATAAGG + Intronic
962521558 3:136201774-136201796 TATTCTTTTATGTTTAGTTCTGG + Intergenic
963187340 3:142433779-142433801 ATTTCTATTATGTTTATACAAGG - Intronic
964027383 3:152092826-152092848 TAATCTATGATTTTTAGATATGG - Intergenic
965876796 3:173333351-173333373 GATTCTATTATTGGTAGAGAAGG + Intergenic
966027280 3:175299935-175299957 GCTTTTATTATTTTGAGATATGG + Intronic
966167263 3:177034320-177034342 TTTTCTTTTTTGTTTAGATATGG - Exonic
966622483 3:181980773-181980795 GAGGTTATTAGGTTTAGATAAGG - Intergenic
966937305 3:184719367-184719389 TATTTTATTATGTTTGGAGATGG + Intergenic
968380141 4:87237-87259 AATTCTCTTATGTTTAGTAAGGG - Exonic
968399015 4:271876-271898 AATTCTGTTATGTTTAGTAAGGG + Exonic
968409298 4:373243-373265 AATTCTCTTATGTTTAGTAAGGG - Exonic
968409314 4:373411-373433 AATTCTCTTATGTTTAGTAAGGG - Exonic
971582350 4:28358114-28358136 GATCATATTTTGTTGAGATAGGG + Intergenic
972241148 4:37193851-37193873 GCCTCTTTTATGATTAGATAGGG - Intergenic
974797333 4:66769596-66769618 TATTCTATTATGTCTAGGTAAGG - Intergenic
974970271 4:68815810-68815832 GTTTCTTTTATGTTTATATTTGG - Intergenic
975420977 4:74164412-74164434 GATTCTAATAAGCGTAGATAAGG + Intronic
975852419 4:78585917-78585939 CATTCCACTATGTTTAGAAAAGG - Intronic
976104136 4:81598815-81598837 TATTATATTATGGCTAGATATGG - Intronic
977192831 4:94021973-94021995 GATTATATAATATTTGGATAGGG + Intergenic
977512238 4:97975768-97975790 ATTCCTATTATTTTTAGATAAGG - Intronic
977710791 4:100122145-100122167 GATTTTATTTTGTATAGCTAGGG - Intergenic
978420029 4:108522032-108522054 TATTATATTAAGTTTAGGTATGG + Intergenic
978597839 4:110397856-110397878 GATTCTCTTATTTCTAGATGAGG - Intronic
979266810 4:118712968-118712990 GATTCATTTGTGTTTAGGTATGG - Exonic
979415862 4:120438166-120438188 AATTCTATTTTTTATAGATATGG + Intergenic
979753260 4:124305718-124305740 GATTTTTTAATGTTTAGTTACGG + Intergenic
979813933 4:125074973-125074995 GATTCTTTTATTTTTACTTAAGG - Intergenic
980275017 4:130639394-130639416 TATTTTAATATGTTTAGGTATGG + Intergenic
980913516 4:139014382-139014404 GATTCTATGTTTTATAGATAAGG + Intergenic
982249936 4:153394500-153394522 GATTTTATTATTATTATATATGG + Intronic
983030455 4:162795032-162795054 GATTTTATTTTCTTTAGATATGG - Intergenic
983057458 4:163114865-163114887 GATTCTTTTATTTTTCCATATGG + Intronic
984642450 4:182182903-182182925 CAGTCTATTATGATTAGCTAAGG + Intronic
985006415 4:185539121-185539143 GATGTAATTAGGTTTAGATAAGG - Intergenic
987096425 5:14554790-14554812 GATTTTATTAAGTTGGGATATGG - Intergenic
987531514 5:19127531-19127553 GATTCTTATATGTTTAAAAATGG + Intergenic
987559453 5:19500347-19500369 GATTCTAATATATTTATATATGG + Intronic
989262033 5:39429258-39429280 GATTATATCATTTTAAGATAAGG + Intronic
989329235 5:40236202-40236224 GATTCATTTATATTTACATACGG - Intergenic
990083638 5:51947598-51947620 TTTTGTATTATGTTTAGAAATGG - Intergenic
991770531 5:70036803-70036825 GAATATATTATCTTTAGAGATGG + Intronic
991849826 5:70912221-70912243 GAATATATTATCTTTAGAGATGG + Intronic
992825754 5:80548301-80548323 GAGTCTAGTATTTTTAGATTGGG + Intergenic
993626963 5:90237567-90237589 ATTTCTATTATTTTTATATAAGG + Intergenic
995271929 5:110230002-110230024 GATTCTTTTATCATTATATATGG - Intergenic
998173933 5:139888877-139888899 GATTCCATTTTGTTTAAAAATGG - Intronic
1000054028 5:157588027-157588049 GATTCTTTTTTTTTTACATATGG + Intergenic
1006191699 6:32213396-32213418 TATTTTATTGTTTTTAGATAGGG + Intronic
1011547954 6:88501136-88501158 TTTTCTTTTATTTTTAGATATGG - Intergenic
1011995027 6:93575553-93575575 GATTTTATTATGTTTATTTTTGG - Intergenic
1012163428 6:95917396-95917418 GATTATTTTTTGTTTATATAAGG - Intergenic
1012838423 6:104298382-104298404 TATTCTATTAAGTAGAGATAGGG + Intergenic
1013838752 6:114364277-114364299 AATTATTTTATGTTTAGCTAAGG + Intergenic
1014196601 6:118567048-118567070 GGTTCTAAAATGTTTAGATCTGG - Intronic
1014600543 6:123406650-123406672 GATTTTCCTATGTTTATATATGG - Intronic
1014948920 6:127530851-127530873 GATTATATGATGTTTTGCTATGG - Intronic
1015374736 6:132497209-132497231 AATTGTAGTATGTTTAAATATGG + Intronic
1016178802 6:141117607-141117629 TTTTCTATAATGTTTTGATATGG - Intergenic
1016879764 6:148899465-148899487 GCTTCTATTATGTTTTAATTTGG + Intronic
1018153800 6:160965944-160965966 GATTCTAGTATGTGTATTTAAGG - Intergenic
1019090664 6:169529897-169529919 AATTCTATTATTTCTAGTTATGG - Intronic
1019857495 7:3624203-3624225 GATTTTATTTTGCTGAGATAGGG + Intronic
1020713674 7:11641427-11641449 AATACTATTATATATAGATAAGG + Intronic
1020729232 7:11860151-11860173 GCATCTATTATATTTATATACGG - Intergenic
1020998458 7:15296016-15296038 TCTTCAATTATGTTTACATATGG + Intronic
1021274801 7:18637103-18637125 GATTTTATTAGGTTCAGAAATGG + Intronic
1023495065 7:40786724-40786746 CATTCTATTATTTTTAGTGAGGG - Intronic
1024653331 7:51427445-51427467 CATTCTATTATTTTCAGATAAGG - Intergenic
1025266496 7:57463298-57463320 TTTTCTATTATGCTTACATAGGG + Intronic
1025266883 7:57469225-57469247 AATTCTCTTATGTTTAGTAAGGG - Exonic
1025748244 7:64266310-64266332 AATTCTTTTATGTTTAGAAAGGG - Exonic
1025792851 7:64707749-64707771 AATTCTCTTATGTTTAGTAAGGG - Exonic
1025822280 7:64977921-64977943 AATTCTTTTATGTGTAGAAAGGG + Exonic
1025867506 7:65398926-65398948 AATTCTTTTATGTTTAGTAAGGG - Exonic
1025867535 7:65399262-65399284 AATTCTTTTATGTTTAGTAAGGG - Exonic
1026235611 7:68524383-68524405 GATGCTAATATTTTTAGATTGGG - Intergenic
1028478690 7:91280301-91280323 GATTCTCTCTTGCTTAGATAGGG + Intergenic
1030091443 7:105862262-105862284 TTTTCTATTATTTTTAGAGACGG - Intronic
1031191607 7:118559289-118559311 GATTATAATATGTTTAAATTTGG - Intergenic
1031271904 7:119661384-119661406 CATCCTATTTTCTTTAGATAAGG - Intergenic
1031770481 7:125834833-125834855 GAGTTTATTATATTCAGATAAGG + Intergenic
1034384326 7:150726206-150726228 GATACTATAATGATCAGATATGG + Intronic
1035829707 8:2681649-2681671 CATTCGATTATGTTTTTATAAGG + Intergenic
1036099462 8:5762164-5762186 GTTTCTTTTATGTTTGTATATGG - Intergenic
1038987294 8:32826011-32826033 AATTCTATTATGAGTAAATATGG - Intergenic
1039726646 8:40224876-40224898 GATTGTGTTATGTCTAGCTATGG + Intergenic
1039808298 8:41022572-41022594 AAATCTATTATTCTTAGATAAGG + Intergenic
1040904993 8:52459258-52459280 GATTCTAGGATGTTTATCTAAGG - Intronic
1042958083 8:74273051-74273073 CTTTCCATTATGTTTAGAGAAGG - Intronic
1043383177 8:79724212-79724234 GATTCTTTTATTTTAAGATGAGG - Intergenic
1045223469 8:100221614-100221636 TATTCTAGTATGTTTAAAGACGG - Intronic
1045380708 8:101621875-101621897 GATTTTATTTTTTTTAGATAGGG - Intronic
1046168980 8:110480104-110480126 GGTTCCCTTATGTTTAGATTTGG + Intergenic
1048272024 8:133037018-133037040 GATTCTAGTGTGTTTATACAAGG - Intronic
1051092006 9:13420864-13420886 CCTTCTATTATGTTTAAATGAGG - Intergenic
1052125790 9:24773201-24773223 GAGGCAATTAGGTTTAGATAAGG - Intergenic
1052264350 9:26553906-26553928 GTTTTAATTGTGTTTAGATAAGG + Intergenic
1053826165 9:42026654-42026676 CACTCTATTATGTTTAGAATGGG - Intronic
1054604397 9:67160743-67160765 CACTCTATTATGTTTAGAATGGG + Intergenic
1056273769 9:84972742-84972764 GATTATATGAAATTTAGATAAGG + Intronic
1057256583 9:93553790-93553812 CATTCTATGTTGTTTAGAGATGG + Intronic
1057257355 9:93560721-93560743 GATTCTATGATGTTCAGTTAAGG + Intronic
1057585869 9:96328241-96328263 CATTCTATATTTTTTAGATAGGG + Intronic
1058733353 9:107871415-107871437 AATTATATTATGTTTATTTAAGG + Intergenic
1058862844 9:109133864-109133886 GATTCTCTTATATTTAAGTAGGG + Exonic
1061379066 9:130243517-130243539 GCTTCTATTAAGTTCAGATCCGG + Intergenic
1203437207 Un_GL000195v1:149941-149963 TATTGTGTTATGATTAGATAGGG - Intergenic
1187783553 X:22857467-22857489 AATTCAATTATGGTGAGATATGG + Intergenic
1187908689 X:24090453-24090475 TATTTTATTTTTTTTAGATAGGG + Intergenic
1187912014 X:24119883-24119905 GATTCCAAAATTTTTAGATAGGG + Intergenic
1187940198 X:24373692-24373714 GATTTTGTTAGGTTTAGATGGGG + Intergenic
1188361886 X:29265215-29265237 GTTTCTTTAATTTTTAGATAAGG + Intronic
1188521595 X:31044282-31044304 GATTCCATTATGATTTGCTATGG + Intergenic
1188829256 X:34876364-34876386 AATTCTATTATGTTTGACTAAGG + Intergenic
1190037281 X:47037415-47037437 GTATCTATTATGTTAAGAGATGG - Intronic
1190166725 X:48079189-48079211 TATTATATTATGGTTATATAAGG - Intergenic
1190530992 X:51376001-51376023 GATTCTATTTTGGGCAGATATGG + Intergenic
1192742802 X:73909775-73909797 GCTCCTATTATTTTGAGATACGG + Intergenic
1192828052 X:74719353-74719375 TATTCTATTATATTTACTTATGG - Intergenic
1193957568 X:87881203-87881225 GTTTTTATTATGTTGAGGTATGG + Intergenic
1194213134 X:91093071-91093093 GATTTTGTTATGTATTGATATGG + Intergenic
1194345121 X:92753529-92753551 GATACTATTCTGTTCAAATATGG - Intergenic
1197186356 X:123591721-123591743 GATTCTAAAATGATTAGAGAAGG + Intergenic
1197367745 X:125585257-125585279 GATTTTATATTGTTTAAATATGG + Intergenic
1197467087 X:126818323-126818345 AATACTATTATTTTTACATAAGG + Intergenic
1198852809 X:140983509-140983531 GATTATATTACATTTATATAAGG - Intergenic
1199190636 X:144965651-144965673 GATTTTATTATTTTTATATATGG - Intergenic
1199283213 X:146026611-146026633 GCTGTTATTATTTTTAGATATGG - Intergenic
1199430272 X:147751742-147751764 TATGATTTTATGTTTAGATATGG + Intergenic
1199781970 X:151069907-151069929 GAGTCTCTTAGGTTAAGATAAGG - Intergenic
1200462786 Y:3478653-3478675 GATTCTCCTCTGCTTAGATATGG - Intergenic
1200653461 Y:5870174-5870196 GATACTATTCTGTTCAAATATGG - Intergenic
1200888911 Y:8300589-8300611 GATTCTAATACTTTTATATAGGG + Intergenic
1201378644 Y:13348162-13348184 TATTAGATTATGTTTTGATACGG + Intronic