ID: 1064614713

View in Genome Browser
Species Human (GRCh38)
Location 10:17141075-17141097
Sequence ATGTCTCATCCAAAACCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064614713_1064614715 12 Left 1064614713 10:17141075-17141097 CCTCATGGTTTTGGATGAGACAT No data
Right 1064614715 10:17141110-17141132 AAATTGTGTCCCCCGCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064614713 Original CRISPR ATGTCTCATCCAAAACCATG AGG (reversed) Intergenic
No off target data available for this crispr