ID: 1064615518

View in Genome Browser
Species Human (GRCh38)
Location 10:17151401-17151423
Sequence CAGTCACAGAACCAGGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 304}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064615513_1064615518 1 Left 1064615513 10:17151377-17151399 CCGCTACCGCAGAATACACACCA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1064615518 10:17151401-17151423 CAGTCACAGAACCAGGACAGAGG 0: 1
1: 0
2: 0
3: 36
4: 304
1064615514_1064615518 -5 Left 1064615514 10:17151383-17151405 CCGCAGAATACACACCACCAGTC 0: 1
1: 0
2: 0
3: 10
4: 164
Right 1064615518 10:17151401-17151423 CAGTCACAGAACCAGGACAGAGG 0: 1
1: 0
2: 0
3: 36
4: 304
1064615512_1064615518 2 Left 1064615512 10:17151376-17151398 CCCGCTACCGCAGAATACACACC 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1064615518 10:17151401-17151423 CAGTCACAGAACCAGGACAGAGG 0: 1
1: 0
2: 0
3: 36
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064615518 Original CRISPR CAGTCACAGAACCAGGACAG AGG Intronic
900430018 1:2596955-2596977 CAGCCAGACAACCAGGACAGGGG - Intronic
901603483 1:10440911-10440933 CAGTAGCAGAGCCAGGACAGCGG + Intronic
903191122 1:21656691-21656713 GAGTCTCAGAGCCAGGGCAGAGG - Intronic
903680332 1:25092127-25092149 CAGCCACAAAGCCAGGAAAGGGG + Intergenic
904811921 1:33168974-33168996 CAGTCAGGGAATAAGGACAGCGG + Intronic
907955883 1:59227860-59227882 CAGTCAAAGAACCATGACTAAGG + Intergenic
909442204 1:75710053-75710075 CAGTGACAGAAGCAGATCAGTGG + Intergenic
910531150 1:88236959-88236981 CATTCACAGAAGCAGCACAGTGG - Intergenic
911040471 1:93587311-93587333 CAGACTCAGACCCAGCACAGTGG - Intronic
911370520 1:96989464-96989486 CAGTCACAGCCCCAGCAGAGGGG + Intergenic
911390378 1:97233605-97233627 TAGCCAAAGAACCAGGAAAGGGG - Intronic
912687422 1:111778339-111778361 CATGCACAGAACCAGGCCGGGGG + Intronic
912954412 1:114144425-114144447 CAGACACAGAACCTGGACTAGGG + Intronic
914197112 1:145453246-145453268 CAGTCAGGGAAGCAGGAAAGGGG + Intergenic
915280355 1:154818286-154818308 CAGAAGCAGAACCAGGCCAGGGG + Intronic
915312156 1:155010258-155010280 GAGCCCCAGAACCAGGACTGGGG + Exonic
915885007 1:159713041-159713063 CAGTCTCAGAATCAGGACACTGG - Exonic
916076175 1:161201129-161201151 CTGCCACAGAGCCAGGGCAGAGG - Intronic
917789367 1:178489559-178489581 CAGGGACAGAACAAGGACAATGG + Intergenic
918598688 1:186325628-186325650 CAGTCACAAAGCTAGAACAGGGG + Intronic
918623407 1:186631065-186631087 CAGTCAAAGCAACAGGAAAGTGG + Intergenic
918885197 1:190183951-190183973 TAGGCACAGAATCAGGAAAGTGG - Intronic
919076961 1:192825431-192825453 CAGCCAAAGAACTAGGAAAGGGG - Intergenic
919880416 1:201897224-201897246 CAGTCACAGGCCCAGGAAGGCGG - Exonic
920421956 1:205840927-205840949 CAGTGACTGAGCCAAGACAGAGG + Intronic
922945340 1:229509074-229509096 AAGTACCAGAACCAGGGCAGAGG - Intergenic
924799489 1:247317333-247317355 AAGCCACAGGACCTGGACAGGGG + Intronic
1063131529 10:3182020-3182042 CAGTTACACAACAAGGAGAGAGG + Intergenic
1064436704 10:15317108-15317130 CAGTCACGGAAACAGGACACAGG + Intronic
1064615518 10:17151401-17151423 CAGTCACAGAACCAGGACAGAGG + Intronic
1066688447 10:38003209-38003231 CAGTCACAGGAGCAGCACAGAGG - Intergenic
1067050078 10:43010698-43010720 CAGGCAGAGAACCACCACAGGGG + Intergenic
1067902930 10:50261312-50261334 CAGTCATAGAACCAACACATTGG - Intergenic
1070345335 10:75536320-75536342 CAAGCACAGAGCCAGGCCAGGGG - Intronic
1070747925 10:78946043-78946065 CAGTGAGAGAAGCAGGATAGGGG - Intergenic
1070817912 10:79336693-79336715 CAGCCACAGGAGCAGCACAGGGG + Intergenic
1072609344 10:97006271-97006293 GTGTCACAAAACCAGGGCAGGGG - Intronic
1073061065 10:100734272-100734294 AAGTCACAGAACCATGATATAGG + Intergenic
1074852749 10:117451827-117451849 CAGTGACAGATCCAGGAATGGGG + Intergenic
1075538923 10:123296043-123296065 GAGTCACAGAATGAGGAGAGAGG + Intergenic
1077506134 11:2930770-2930792 CATTCACAGAACCGGGTCTGGGG - Intergenic
1077758772 11:5066888-5066910 TGGTCTCAGAACCAGGACATGGG + Intergenic
1078781387 11:14442369-14442391 CAGTCAAAGTTCCAGGACAGAGG + Intergenic
1078855267 11:15201575-15201597 CAGTCGCACAACCAGGGAAGGGG - Intronic
1080265171 11:30392804-30392826 CAGTCACTGAACCAGGAGGAAGG + Intronic
1081683679 11:45026526-45026548 CAGTCACAGCAGCAACACAGTGG + Intergenic
1082982718 11:59137926-59137948 CAACGACAGAACCAGGACAGAGG + Intergenic
1085024264 11:73227652-73227674 AAAGCACAGAACCAGGACCGAGG + Intronic
1085033305 11:73285703-73285725 CAGGCAATGAAACAGGACAGAGG + Intronic
1087505986 11:99021231-99021253 GAGTCACAGAGGAAGGACAGTGG + Exonic
1089015401 11:115161289-115161311 CACTCAGAGATCCAGGACAGGGG + Intergenic
1090839607 11:130476642-130476664 CAGTCACAGAGGCAGGACACAGG - Intergenic
1091742376 12:2968941-2968963 CACTCACAGGCCCAGCACAGTGG - Intronic
1094345178 12:29460471-29460493 CAGGCACAGAGCCAGGACATGGG - Intronic
1096091450 12:48904510-48904532 CAGTGACAGGGCCAGGGCAGGGG - Intronic
1100118815 12:91344119-91344141 CAGTTCCAGAAACAGAACAGTGG - Intergenic
1101910825 12:108858970-108858992 AGGTCACAGCCCCAGGACAGAGG - Intronic
1101988897 12:109468426-109468448 CAGTCTCAGAAACAGGAAGGCGG + Intronic
1104052605 12:125206195-125206217 AAGCCACAGCACCAGGAAAGGGG - Intronic
1105796182 13:23855758-23855780 CAGTAAAAGAACCAGGAAAAGGG - Intronic
1106023843 13:25939409-25939431 CAGGCACAGGACCAGGACGGAGG + Intronic
1106043079 13:26112489-26112511 CAGTCACAGAAACAGCCCTGAGG + Intergenic
1107427574 13:40309174-40309196 CAGTTAAAGAACCAGGTCATTGG + Intergenic
1107657043 13:42602151-42602173 AGGTCACAGAGCCAGGACAATGG - Intronic
1107761415 13:43683348-43683370 CAGTTACAGAAGCAGGTCTGGGG + Intronic
1108097949 13:46924279-46924301 TAGCCAAAGAACCAGGAAAGGGG - Intergenic
1113207781 13:107937548-107937570 TTGTCTGAGAACCAGGACAGGGG + Intergenic
1115579730 14:34746028-34746050 TAGCCAAAGAACTAGGACAGGGG - Intergenic
1116288694 14:43005314-43005336 AAGTTACAGAAACAGGACATGGG + Intergenic
1116574618 14:46557321-46557343 CAGTCACACCACCTGGAGAGGGG - Intergenic
1117118836 14:52547197-52547219 CAGCCACAGAAAGAGGTCAGAGG + Intronic
1118905325 14:70019241-70019263 CAGTCACAAAAACAGCCCAGAGG + Intronic
1121016925 14:90554528-90554550 CTGGCACAGCACCAGGACATTGG - Intronic
1121599882 14:95195437-95195459 CAGGCACAGAAGCAAGGCAGAGG + Intronic
1122623142 14:103071017-103071039 CAGACACACAGCCAGGAGAGAGG - Intergenic
1122952216 14:105051249-105051271 CAGGCACAGAAACACCACAGAGG + Exonic
1123020930 14:105397635-105397657 GAGGCACTGAACCAGGACACTGG - Exonic
1123031938 14:105456071-105456093 CAGGCCCAGACCCAGCACAGCGG - Intronic
1124706382 15:31970073-31970095 CAGCCACAGAACAAGAAAAGGGG + Intergenic
1125254296 15:37745200-37745222 CACTCACAGAACAATGAGAGGGG + Intergenic
1127703865 15:61528099-61528121 CAGTCTCAGGACCAGGACCCGGG + Intergenic
1128063740 15:64751407-64751429 AATTCGCAGAACCAGGACACGGG + Intronic
1128403699 15:67313406-67313428 GAGTCACATAACCAGGACTGTGG - Intronic
1130931014 15:88428106-88428128 CAGCCACAGAGGAAGGACAGTGG - Intergenic
1130939369 15:88494997-88495019 CAGTAAGAGAACAAGGACAAGGG - Intergenic
1131277765 15:90996156-90996178 CATTCACAGCACCAACACAGTGG + Intergenic
1132227890 15:100157136-100157158 CTGTCACAAGAACAGGACAGAGG + Intronic
1132276835 15:100573909-100573931 CAGGCACAGATCCACGACAGAGG + Exonic
1132540769 16:508220-508242 CAGTCACAGCACCGGGTCAGAGG - Intronic
1132556943 16:576677-576699 GAGTTACAGAATCAGCACAGGGG - Intronic
1132870216 16:2112493-2112515 CAGTGAGTGAACCGGGACAGGGG + Intronic
1132998614 16:2837815-2837837 CAGGCACACAGCCTGGACAGGGG + Intronic
1133270028 16:4606632-4606654 GAGCCACAGAACTAGCACAGAGG + Intergenic
1134522326 16:14924463-14924485 CAGTGAGTGAACCGGGACAGGGG - Intronic
1134709996 16:16323114-16323136 CAGTGAGTGAACCGGGACAGGGG - Intergenic
1134717211 16:16363114-16363136 CAGTGAGTGAACCGGGACAGGGG - Intergenic
1134949607 16:18345531-18345553 CAGTGAGTGAACCGGGACAGGGG + Intergenic
1134957540 16:18389045-18389067 CAGTGAGTGAACCGGGACAGGGG + Intergenic
1135583445 16:23648014-23648036 AAGACACAAAATCAGGACAGCGG - Intronic
1135648593 16:24185810-24185832 CAGTCTCTGAACCAGCACAGGGG + Intronic
1136779503 16:32887426-32887448 CACTCAAGGACCCAGGACAGGGG + Intergenic
1136891113 16:33974092-33974114 CACTCAAGGACCCAGGACAGGGG - Intergenic
1139251596 16:65501768-65501790 CACACACACAACCAGGACAAGGG + Intergenic
1140415808 16:74773491-74773513 CAGTCCCAGAGCCAGGCCTGGGG + Intronic
1141152240 16:81572312-81572334 CATTCACAGAAACAGGGCAAGGG - Intronic
1141769007 16:86077570-86077592 CAGTCACAAAACAAGAACAACGG - Intergenic
1142181416 16:88672730-88672752 CACTCAGAGAACAAGCACAGGGG + Intergenic
1142248667 16:88981121-88981143 CAGTCACAAAGCCTGGAGAGAGG + Intergenic
1142325926 16:89414612-89414634 CAGTCTCCTACCCAGGACAGTGG - Intronic
1203081919 16_KI270728v1_random:1149514-1149536 CACTCAAGGACCCAGGACAGGGG + Intergenic
1142867476 17:2799473-2799495 CAGTCACAGCTCCAGGGAAGAGG - Intronic
1143184927 17:5004346-5004368 CAGTCACAGAACCATGGAAGGGG - Intronic
1143766365 17:9140323-9140345 CTGCCACAGCACCAGGGCAGGGG - Intronic
1144065628 17:11621744-11621766 AAGACACAGAATCAGGAAAGTGG + Intronic
1144083607 17:11786819-11786841 CAGGCAGAGAAACAGGCCAGGGG - Intronic
1144849654 17:18237635-18237657 CAGGCACTGCACCAGGACACGGG - Exonic
1146284740 17:31566834-31566856 CAGACACAGAAGGAGGAGAGAGG - Intergenic
1146508326 17:33424500-33424522 CAGTCACAGAGCCAGAGCTGGGG - Intronic
1146749236 17:35362731-35362753 CAGACACAGATCCAGGTAAGAGG - Exonic
1147454773 17:40530420-40530442 CAGTCAGAGATCCAGGACGAGGG - Intergenic
1147594124 17:41705804-41705826 CAGGTTCAGAAGCAGGACAGGGG + Intergenic
1147612119 17:41807999-41808021 CATTCACTGCAGCAGGACAGGGG + Exonic
1148322371 17:46765271-46765293 CAGTAACAGATCCAGGACTTGGG + Intronic
1150951738 17:69810235-69810257 CAGTCACTGGACCAGCACTGGGG - Intergenic
1151683811 17:75635404-75635426 CAGTCCCTGAACCAGGACGGAGG + Intronic
1151741321 17:75984199-75984221 CAGTGAGAGAATTAGGACAGCGG - Intronic
1152266927 17:79300583-79300605 CAGTGACAGAACCAGGAGGCTGG + Intronic
1153034395 18:746300-746322 CAGTCACAGGAACAGTAGAGAGG + Intronic
1153460047 18:5323085-5323107 CAGTTACAGAATCAGGAAGGTGG - Intergenic
1158699820 18:59735728-59735750 CAATAACAGAGACAGGACAGAGG - Intergenic
1160041603 18:75350460-75350482 CAATCACAAAACCAAGACAGAGG + Intergenic
1160246035 18:77160370-77160392 CAGTCACAGCATTAGGAAAGAGG + Intergenic
1160576272 18:79855728-79855750 CCGTCACAGCACGAGGGCAGAGG - Intergenic
1160840459 19:1144424-1144446 TGCTCACAGAACCAGCACAGTGG + Intronic
1161164917 19:2781501-2781523 CATTCACAAAAACAGGCCAGAGG + Intronic
1161524176 19:4743180-4743202 CAGACACAGACCAAGGCCAGAGG + Intergenic
1161767208 19:6214341-6214363 AAGCCACAGAACCAAGTCAGAGG - Intronic
1162062287 19:8103510-8103532 CAGTCACAGAAGCAGCACCTGGG - Intronic
1163176788 19:15569814-15569836 CAGTCAGAGAACAAGAGCAGAGG - Intergenic
1165897253 19:39150174-39150196 CAGTCACAGCAACAGAGCAGCGG - Intronic
1166231465 19:41427590-41427612 CAGCCACAGAAACAAGACGGGGG + Intronic
1167300543 19:48675012-48675034 CGGTCACACAGCTAGGACAGAGG - Intergenic
1167529682 19:50007513-50007535 TCGTCTCAGCACCAGGACAGTGG - Intronic
1167554807 19:50187967-50187989 CAGGCTCAGATTCAGGACAGGGG + Intergenic
1167896676 19:52587374-52587396 CAGTCCCAGAAAAAGGAAAGAGG - Intergenic
1167945102 19:52981810-52981832 CAGTCCCAGAAAAAGGAAAGAGG + Intergenic
1168578980 19:57537449-57537471 CAGCACCAGAACCAGGACAGTGG + Exonic
925678569 2:6392428-6392450 CAGTCACAGCTCCCAGACAGTGG - Intergenic
925976701 2:9146755-9146777 CAGTTACAGATCCAGGTCAGGGG - Intergenic
926107912 2:10163741-10163763 CAGGCAGAAAACCAGGAGAGGGG - Intronic
926646963 2:15300634-15300656 CAGTCACTGAACAACTACAGTGG + Intronic
926888431 2:17618619-17618641 TATTCACAGAACCTGGGCAGAGG - Intronic
927451312 2:23211781-23211803 CAGCCACAGAGCCTGGACGGAGG + Intergenic
930088085 2:47512399-47512421 GAGAGACAGAACCAGGGCAGTGG + Intronic
931547491 2:63405785-63405807 GAGTCCAAGAACCAGGAGAGTGG + Intronic
931619787 2:64198397-64198419 AAGTCACAGAACCGTGACTGTGG + Intergenic
932803610 2:74764455-74764477 CAGGCACAAAGCCAGCACAGAGG + Intergenic
934809367 2:97267120-97267142 CAGTCCCAGAACACTGACAGGGG - Intergenic
934828083 2:97489832-97489854 CAGTCCCAGAACACTGACAGGGG + Intergenic
936539462 2:113338301-113338323 CAGACACAGCAGCAGGACTGGGG - Intergenic
937226306 2:120371926-120371948 CAGTCCCAGAGCCAGGAAAGGGG + Intergenic
938664637 2:133521952-133521974 CAGTCACATAACAAGCAGAGAGG - Intronic
940819748 2:158339720-158339742 GAGTCACATCAACAGGACAGAGG + Intronic
941925041 2:170885922-170885944 CAGACACAGAACGAGACCAGTGG - Intergenic
941957812 2:171222173-171222195 CATTCACAGACCCAGGATAAGGG - Intronic
942043696 2:172087017-172087039 CAGTGACAGAGCTAGGGCAGAGG - Intronic
942467524 2:176224362-176224384 CAGTCACAGAAGCAGAATTGAGG + Intergenic
942812289 2:180013501-180013523 CAGTAAGAGGACCAGGAAAGCGG - Intergenic
945837438 2:214849640-214849662 AAGTCTCAGAACCTGGATAGTGG - Intergenic
946229640 2:218283309-218283331 CAGTGGCATAACCAGGACGGAGG + Intronic
946326599 2:218987682-218987704 AAGTCACATAACCAGGAAATGGG - Intergenic
946815343 2:223571444-223571466 CAGTCATACAGCCAGGGCAGAGG + Intergenic
947455246 2:230248322-230248344 CAGTGACACATCCAGGACACTGG - Intronic
947455782 2:230252771-230252793 CAGTGACACATCCAGGACACTGG - Intronic
947942748 2:234072762-234072784 CAGGCTCAGAACCAGGCCCGTGG - Intronic
948572231 2:238924936-238924958 CTGTCGCAGAGGCAGGACAGGGG - Intergenic
948748629 2:240113828-240113850 CTTTCACAGAGCCAGGCCAGAGG + Intergenic
948785907 2:240352869-240352891 TAGTCAAAGGACCAGGACAGAGG + Intergenic
1170858695 20:20082337-20082359 AAATCAAAGAAACAGGACAGGGG - Intronic
1171460846 20:25297079-25297101 CAGGTGCAGAGCCAGGACAGAGG - Exonic
1172067064 20:32228757-32228779 CAGACACTGAGCTAGGACAGGGG - Intronic
1173822082 20:46026005-46026027 CATCCACTGAACCAGGACAAGGG - Intronic
1174369651 20:50077990-50078012 CAGTCAGAGATCCAGGGCAGTGG + Intergenic
1174555518 20:51392664-51392686 CAGTGTCAGAACCAGGAAATGGG - Intronic
1178312820 21:31543921-31543943 CAGTCTAAGACCCAGCACAGTGG + Intronic
1178618414 21:34153669-34153691 CAGTCACAGACACAGAACAGCGG - Intergenic
1178810577 21:35877705-35877727 CAGCCACACAGCAAGGACAGAGG - Intronic
1179141459 21:38729243-38729265 CAGCCACACAACCAAGATAGAGG + Intergenic
1181523040 22:23460232-23460254 CAGTCTGAGGACCTGGACAGGGG - Intergenic
1183238253 22:36636432-36636454 CATACACACAACCTGGACAGGGG + Intronic
1184101821 22:42344784-42344806 CAGGCCCAGAGCCAGGACGGAGG - Intergenic
1184254546 22:43279701-43279723 CTGTGACAGAAGCTGGACAGGGG - Intronic
1184300970 22:43560754-43560776 AAGTCACAGAACCAACAGAGTGG + Intronic
1184678486 22:46056193-46056215 TAGTCACAGTGCCAGGGCAGCGG + Intronic
949253021 3:2010304-2010326 TAGCCAGAGAACCAGGAAAGGGG + Intergenic
949302342 3:2598835-2598857 CAGCCACAAAACCAAGAGAGTGG - Intronic
949348261 3:3097577-3097599 AAGTCACAGCTCAAGGACAGAGG + Intronic
949388947 3:3537584-3537606 CAGTGGCAAAACCAGGACTGGGG - Intergenic
950098467 3:10343561-10343583 CCCTCCCAGAACCTGGACAGTGG - Intronic
952808723 3:37382073-37382095 TAGCCAAGGAACCAGGACAGAGG - Intergenic
953734922 3:45485075-45485097 CACTCACAGAACAAAGACAGAGG - Intronic
954467980 3:50668248-50668270 GGGTCACAGAACCTGGAGAGTGG + Intergenic
955856308 3:63277688-63277710 CAGAGAGAGGACCAGGACAGAGG - Intronic
961061374 3:123831907-123831929 CAGACGCAGAACCATGACGGTGG + Intronic
962027812 3:131567096-131567118 CAGTCAGACAACCAGCACATGGG - Intronic
963182809 3:142377898-142377920 CAGTCATGAAACCAGGAGAGTGG - Intronic
963263410 3:143215084-143215106 GAGTGAAAGAAACAGGACAGAGG - Intergenic
966091858 3:176147941-176147963 TATTCACAGAATCAGGAAAGAGG + Intergenic
966230621 3:177647785-177647807 CACTCACAGTTCCAGGTCAGAGG - Intergenic
966390590 3:179448948-179448970 CAGTCACTGAAGCAGAACACTGG + Intronic
969594639 4:8142147-8142169 CTGTCCCAGATCCAGGAAAGAGG - Intronic
969893426 4:10280503-10280525 TGGTCACAGAACCAGAACAATGG + Intergenic
970405315 4:15757425-15757447 AGGTCACAGGACTAGGACAGTGG - Intergenic
971091071 4:23346474-23346496 CAGTCTCAGACCCAGGCAAGAGG + Intergenic
971819982 4:31539397-31539419 AAGTCACAGTACTAGGAAAGAGG + Intergenic
972582603 4:40407806-40407828 CAGTCAGAGAAGCAGGAGGGTGG - Intergenic
973344109 4:49036093-49036115 GAGACCCAGAACCAGGACAAGGG + Intronic
974039357 4:56844601-56844623 CAGTCACAGACCAGGGACAACGG + Intergenic
974391219 4:61271717-61271739 CTTTCACAGAACCAGGATGGAGG + Intronic
974401530 4:61413629-61413651 GAGCCAAAGAACCAGGAAAGGGG - Intronic
975215201 4:71745290-71745312 CAGTCTGAGAACCAGTACAAGGG - Intronic
977913417 4:102563677-102563699 AAGTCACACAACCAGGAAATGGG + Intronic
980994195 4:139764881-139764903 CAGTCACTGAAGCAGGAGTGTGG - Intronic
982193701 4:152886126-152886148 GAGTCACTGAATCAGGACAAAGG - Intronic
982285991 4:153735313-153735335 CAGTCACTGATCCATGACAAAGG - Intronic
988481106 5:31631302-31631324 CTGTCAGAGAACCAGGACCAGGG + Intergenic
988822051 5:34896835-34896857 AAGGCACAGAAGCATGACAGAGG + Exonic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
994871913 5:105362354-105362376 GAGAGACAGAACCAGGCCAGTGG - Intergenic
997162560 5:131624696-131624718 CAATGACAGAACCAGAAGAGTGG + Intronic
998423125 5:142005518-142005540 CACCCAGAGAACCTGGACAGGGG + Intronic
998950261 5:147386619-147386641 CAGTCACAGAAGCAGCTCACTGG - Exonic
998991132 5:147818410-147818432 CAATCAGAGAAGTAGGACAGAGG + Intergenic
999381325 5:151123542-151123564 CAACCACAGACCCAGCACAGGGG + Intronic
999681017 5:154060092-154060114 CAGTCACAGAAGCAGGCAGGGGG + Intronic
1001180207 5:169513287-169513309 CACACACAGAAACAGGGCAGAGG + Intergenic
1001741747 5:174058614-174058636 CAGCAACAGAACCAAGAGAGAGG + Intronic
1001854177 5:174996358-174996380 CAGATATAGAACCAGGAGAGAGG + Intergenic
1002256136 5:177959612-177959634 GCGTCACAGCCCCAGGACAGCGG + Intergenic
1003011356 6:2430392-2430414 GAGGCACAGAACCATGCCAGGGG - Intergenic
1003399196 6:5777973-5777995 CAGTGACAGAAACAGATCAGAGG + Intergenic
1003492173 6:6632547-6632569 CTGTCATAGAAACAGGCCAGAGG + Intronic
1003530221 6:6930766-6930788 AATTCACAGAACCAGGAAAGAGG - Intergenic
1004290455 6:14362373-14362395 AGGTCACAAAACCAGGACTGAGG - Intergenic
1004586935 6:17011855-17011877 TAGGCAGAGAACCAGGAGAGTGG - Intergenic
1005186966 6:23173433-23173455 CACTCACAGAAACAGGATACAGG - Intergenic
1006080400 6:31562094-31562116 CAGTCAGAGAAGCAGGGCACGGG + Intergenic
1006106413 6:31719483-31719505 AAGTGATAGAACCAGGACTGGGG - Intronic
1006583999 6:35093740-35093762 CAGCCAGAGGACCAGGAAAGGGG + Intergenic
1006628349 6:35413385-35413407 CAGTCATTGAAACAGGAGAGAGG + Intronic
1007046927 6:38785221-38785243 CAGTCACATCACTAGGACAAAGG - Intronic
1007228629 6:40332249-40332271 CAGTCTGAGATCCAGGACAATGG - Intergenic
1008955722 6:57213842-57213864 GAGTCAAAGGACCAGGAAAGGGG + Intronic
1009194174 6:60664762-60664784 CAATCACTGAACCAGGAGCGGGG + Intergenic
1009824152 6:68845358-68845380 CAGCCCCAGAACCTGGAGAGAGG + Intronic
1013329853 6:109089511-109089533 CAGTGACAGAACTAGAACAGCGG + Intronic
1013535780 6:111061894-111061916 CATTCCCAGAACCAGGAAAAAGG + Intergenic
1015682973 6:135828458-135828480 CAGGCAAAGAACCTGGAGAGAGG + Intergenic
1016403930 6:143710103-143710125 TAGCCACATAACCAGGAAAGGGG - Intronic
1017130709 6:151106298-151106320 CTGCCACAGAACCAGGACCTAGG - Intergenic
1017681472 6:156868532-156868554 CAGTCCCGGAACCAGGAAACAGG - Intronic
1017871371 6:158489230-158489252 CAGCCACAGAACCTGGGCTGAGG - Intronic
1017941597 6:159058007-159058029 TGGCCACAGAACCAGGACAATGG + Intergenic
1018251244 6:161872717-161872739 CAGTCCTAGTCCCAGGACAGAGG - Intronic
1019588292 7:1816331-1816353 CAGTCTGAGGACCTGGACAGGGG + Intronic
1020098279 7:5380467-5380489 CAGTCCCAGAAGCAGAAGAGAGG + Intronic
1021652503 7:22845771-22845793 CAGTCACAGAGGCAGAAAAGAGG + Intergenic
1021781272 7:24109098-24109120 CAGGCACTGAAACAGGAAAGAGG - Intergenic
1022222880 7:28331552-28331574 GAGTAAAAGAACAAGGACAGAGG - Intronic
1022483959 7:30763494-30763516 AAGTCAGAGAACCAGGGGAGAGG + Intronic
1022562517 7:31364477-31364499 AAATCACAAAACCAGGAGAGGGG - Intergenic
1023495162 7:40787709-40787731 TAGCCAAAGAACCAGGAAAGGGG + Intronic
1023585856 7:41729092-41729114 CAGTCAGAGAAGCAGGGCAGAGG - Intergenic
1024207134 7:47173395-47173417 CAGTCTCAGAAGCTGGACACAGG - Intergenic
1026239212 7:68557402-68557424 CAGACACAGATCCAGGTCACGGG + Intergenic
1026450593 7:70525853-70525875 CAGTCACAAAGGAAGGACAGAGG + Intronic
1026470303 7:70689425-70689447 CAGGGTCAGAACCTGGACAGTGG - Intronic
1027172428 7:75882138-75882160 GAGCCACGGAACCAGGACTGAGG - Exonic
1028450300 7:90974502-90974524 AAGTCAGAGACCCAGAACAGAGG - Intronic
1030104581 7:105976098-105976120 CAGTCACAGAACCAGCATCTGGG - Intronic
1032666216 7:134039063-134039085 CATACACAGAAGCAGGAGAGGGG - Intronic
1033340947 7:140491827-140491849 ATGTCACAGATCCAGGACAAAGG - Intergenic
1033346123 7:140526720-140526742 CAGACACAAATGCAGGACAGAGG + Intronic
1033452427 7:141473769-141473791 CAGCCACATGACCAGGATAGAGG + Exonic
1034006054 7:147473458-147473480 CAATTACACAACCAGAACAGAGG - Intronic
1034563383 7:151895493-151895515 CAGTGTCAGAACATGGACAGAGG - Intergenic
1037370973 8:18178462-18178484 CACTCACAGAACCTGGATTGAGG + Intronic
1038122318 8:24631293-24631315 CAGACACAGACCTAGGACTGTGG - Intergenic
1039456471 8:37710753-37710775 CAGTCACAGAGCCAGGAGGGTGG - Intergenic
1039547440 8:38420270-38420292 CACTCACAGAATGAGGACAGAGG + Intronic
1041135813 8:54757639-54757661 CAGACACAGAAGCAGGAGACAGG + Intergenic
1041461637 8:58118208-58118230 ATGTCACAGAACAAGGTCAGTGG - Intronic
1041872691 8:62652948-62652970 AAGAAACAGAACCAGGAAAGGGG + Intronic
1044720440 8:95140409-95140431 CAGACACAGAAGCAGTACACGGG - Intronic
1047940966 8:129827022-129827044 CACTTTGAGAACCAGGACAGAGG - Intergenic
1048273003 8:133044378-133044400 CCTTCACAGACCCAGGAGAGAGG - Intronic
1049005424 8:139852488-139852510 CAGTGGCAGAACCAGGACCAGGG - Intronic
1049365853 8:142236513-142236535 CAGTCACAGAAACAGGGGAGGGG - Intronic
1049642928 8:143723491-143723513 CAGTCAGAGACCCAGCCCAGGGG + Intergenic
1050521018 9:6499883-6499905 CAGTCAAAGAAGCAGCCCAGTGG + Exonic
1050572603 9:6956927-6956949 CAGAAACAGAACCAAGCCAGAGG - Intronic
1051681364 9:19611239-19611261 CAGTCAGAGAAGCAGAACAAGGG + Intronic
1052036220 9:23684077-23684099 CAATCACAGACCCAGGAAGGAGG + Intergenic
1052970464 9:34374135-34374157 CTATGACAGAAACAGGACAGTGG - Intronic
1055518315 9:77055260-77055282 AAGTCACAGAAGGAGGAAAGAGG - Intergenic
1056867682 9:90244169-90244191 AAGTAACACAACCAGGAAAGAGG - Intergenic
1056879757 9:90379947-90379969 CAGTCACATAGCCAGTAAAGGGG + Intergenic
1056965655 9:91161253-91161275 CAGACACAGCAACAGGACAGAGG + Intergenic
1058250635 9:102691592-102691614 CAGCCAAAGAACCAGGACCAGGG - Intergenic
1059117933 9:111616164-111616186 TAGTCACAGAACCAGAGCTGTGG + Intergenic
1059199884 9:112404752-112404774 TAGGCACAGAGCCAGGAGAGAGG + Intronic
1059571908 9:115446676-115446698 CAATTACAGAACCATGACACAGG + Intergenic
1060405396 9:123370558-123370580 CAGTCTCAGGACAAGCACAGTGG - Exonic
1061202564 9:129146169-129146191 CAGCCGCAGATCCAGGCCAGAGG - Intronic
1061334143 9:129919083-129919105 CATTCACAGCACCAAGACTGGGG - Intronic
1061401758 9:130372317-130372339 CAGACACAGGAGCAAGACAGTGG + Intronic
1062149095 9:135008197-135008219 CAGTCCCAGAATAGGGACAGTGG - Intergenic
1062170757 9:135133451-135133473 GACCCACAGGACCAGGACAGGGG + Intergenic
1062697619 9:137883596-137883618 CAGTCAGGGAAGCAGGAAAGGGG - Intronic
1187457249 X:19452995-19453017 CAGTCACAGAAACAGAAGAATGG + Intronic
1187477592 X:19625891-19625913 CAGTGGCAGAGCCAGGTCAGAGG - Intronic
1187822100 X:23298624-23298646 CAGCCACTGAGCCAGGACAGGGG - Intergenic
1188234614 X:27712614-27712636 CAGTCACAGAAGCATGGAAGCGG - Intronic
1189301597 X:39956355-39956377 CAGTCACAGAGCCACCAAAGAGG + Intergenic
1189454821 X:41176429-41176451 AAGACACAAAACCAGTACAGAGG + Intronic
1189550251 X:42085326-42085348 GACTCACAGACACAGGACAGTGG - Intergenic
1189824501 X:44903532-44903554 AAGTCACAGAAGAAGGAGAGGGG - Intronic
1190277096 X:48905722-48905744 CAGTCACACAGCCAGGAAATGGG - Intronic
1191122718 X:56922676-56922698 CAGTCACAAAAACAGAAAAGGGG - Intergenic
1191776864 X:64823916-64823938 CAGCCAAAGGACCAGGAAAGGGG + Intergenic
1192157613 X:68758275-68758297 CAGTCACAGAGCAAGGGCAAAGG + Intergenic
1192762463 X:74107519-74107541 CAGTCAAAGAAGCAGGCCAGTGG + Intergenic
1193097306 X:77564781-77564803 CAGCCAAAGGACCAGGAAAGGGG + Intronic
1194535563 X:95102341-95102363 CAGTAAGGGAACTAGGACAGGGG - Intergenic
1197095488 X:122589610-122589632 CAGTCACACAACCTTGAGAGTGG + Intergenic
1198331986 X:135630539-135630561 CAATCAGAGCACCAGGAAAGAGG - Intergenic
1198334272 X:135651789-135651811 CAATCAGAGCACCAGGCCAGAGG + Intergenic
1198960346 X:142175674-142175696 CAGGCACAGGGACAGGACAGGGG + Intergenic
1199830071 X:151540356-151540378 CAGCCAAAGGACCAGGAAAGGGG - Intergenic
1199945758 X:152665754-152665776 CAGCCAAAGGACCAGGACAGGGG + Intergenic
1200100253 X:153686572-153686594 CACTCAAGGACCCAGGACAGAGG - Intronic