ID: 1064616089

View in Genome Browser
Species Human (GRCh38)
Location 10:17158506-17158528
Sequence AAAAGTCATGTCTACTAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064616089_1064616090 1 Left 1064616089 10:17158506-17158528 CCTTATTAGTAGACATGACTTTT 0: 1
1: 0
2: 0
3: 17
4: 197
Right 1064616090 10:17158530-17158552 TGTCCTTACCTATGAAAGTTAGG No data
1064616089_1064616091 2 Left 1064616089 10:17158506-17158528 CCTTATTAGTAGACATGACTTTT 0: 1
1: 0
2: 0
3: 17
4: 197
Right 1064616091 10:17158531-17158553 GTCCTTACCTATGAAAGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064616089 Original CRISPR AAAAGTCATGTCTACTAATA AGG (reversed) Intronic
901485165 1:9554699-9554721 AAAAGTTATGTTTAATAAAATGG + Intronic
902487137 1:16756340-16756362 AATAGTGATATCTACTAATAAGG - Intronic
904281911 1:29426616-29426638 AAATCTCATGCCTACTAAAAAGG - Intergenic
905466133 1:38155070-38155092 AAAAGTCATTTTTAAAAATAAGG + Intergenic
908358988 1:63349150-63349172 TAAAACCATGTCTACTATTAAGG + Intergenic
910480663 1:87655040-87655062 AAAAGTCCTGTCTTCAAATGTGG - Intergenic
911311442 1:96296841-96296863 AAAAGTCAGGTCACCTAAAAAGG - Intergenic
913209337 1:116570403-116570425 AAAAGTCCTCTCTGCTGATACGG + Intronic
913424982 1:118718457-118718479 AAAAGTCTTTTATACTACTAAGG + Intergenic
913685320 1:121226233-121226255 AAAAGTCTTTTCTTCTAAGAGGG - Intronic
913699235 1:121358085-121358107 AAAAGTCATTTCAACTTTTAGGG + Intronic
914138310 1:144921960-144921982 AAAAGTCATTTCAACTTTTAGGG - Intronic
919056646 1:192579217-192579239 AAAAGTCATATATACTCTTATGG + Exonic
919571918 1:199259851-199259873 ATAAATCATGTCTACTCACATGG + Intergenic
919650046 1:200139252-200139274 AAAAGCCATTTCAAATAATAAGG - Intronic
920253277 1:204637047-204637069 ATAAGGCAAGTCTAATAATAAGG + Intronic
920486646 1:206376797-206376819 AAAAGTCATTTCAACTTTTAGGG + Intronic
920618567 1:207521150-207521172 AAAACCCATCTCTACTAAAAGGG - Intronic
921312975 1:213862769-213862791 AAAAGTGATCTATAGTAATAAGG - Intergenic
923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG + Intronic
924843355 1:247738337-247738359 AAAAGTCATTTCAAGTAATGAGG + Intergenic
924918041 1:248594200-248594222 AAGAGTCATGTCTGCAAAAAAGG + Intergenic
1064616089 10:17158506-17158528 AAAAGTCATGTCTACTAATAAGG - Intronic
1064734568 10:18368229-18368251 AATGGTCATTTCTACTAATATGG + Intronic
1065098759 10:22311907-22311929 AAAAGTCATGTCTACTCTTTAGG - Intergenic
1066242315 10:33550189-33550211 ACAGGTCATGCCTACTAACAGGG - Intergenic
1069390186 10:67927031-67927053 ATAAATCATGGCTACAAATAAGG - Intronic
1073722317 10:106186875-106186897 AAAAGCCTCGTCTACTTATAAGG - Intergenic
1074664694 10:115707132-115707154 AAAAATAATGGCTACAAATAAGG + Intronic
1074816133 10:117141936-117141958 AAAATTGATGTCTAATAATAAGG - Intergenic
1075126916 10:119707884-119707906 AAAAGCCCTGTCTCCAAATAAGG - Intergenic
1075448381 10:122529777-122529799 AAAAATCATGTCACCTAAGAAGG + Intergenic
1076327013 10:129632150-129632172 AAAAGTCATGTCTAAGGATGTGG - Intronic
1077909321 11:6560329-6560351 ATATGTCGTGTCTACTAATATGG + Intronic
1078088786 11:8251140-8251162 AACAGTCATGTCTCCATATATGG + Intronic
1080068156 11:28044146-28044168 AAACTTCATGTCTTTTAATAGGG - Intronic
1080567229 11:33521873-33521895 AAAAATCATGTCTAATGATATGG + Intergenic
1080720049 11:34839912-34839934 AAAAGCCATGTAGACTAATGAGG - Intergenic
1080898385 11:36464643-36464665 AAATGTTAAGTGTACTAATAAGG - Exonic
1083578662 11:63811209-63811231 AGAAATAATGTCTACTAATTGGG + Intergenic
1086770615 11:90760567-90760589 AAAAATCTAGTCTAATAATAGGG - Intergenic
1087614726 11:100474770-100474792 AAAAGTCCTGTTTCCAAATAAGG - Intergenic
1088780579 11:113130440-113130462 CAAAGTGATGTATATTAATAGGG + Intronic
1088923221 11:114276825-114276847 AAAAGCCATGTCTCCTGATGCGG - Intronic
1089136730 11:116255194-116255216 AAAAATCCTGTCTCCAAATAAGG + Intergenic
1092658688 12:10715598-10715620 CAAAGTCATGTCAATTCATAAGG + Intronic
1095453805 12:42360837-42360859 AAAAGTCAACTATACCAATAAGG - Intronic
1099588311 12:84550304-84550326 CAATGTCAGGTTTACTAATAGGG - Intergenic
1099999906 12:89820722-89820744 AAAAGTGAAGTCTGTTAATAAGG + Intergenic
1100412746 12:94338496-94338518 AAAAGTAATTTCTACTTAAAAGG + Intronic
1101109749 12:101474021-101474043 AAAAATCATTTCTTCTCATAAGG + Intergenic
1101658344 12:106744063-106744085 AAATGTCATGTTTATTAAAATGG - Intronic
1104914807 12:132259138-132259160 AAATGCCAGGTCTTCTAATAAGG + Intronic
1105567920 13:21569780-21569802 AAAAATGGTGTCTACTATTAAGG - Intronic
1109617035 13:64848627-64848649 AAAAGTCTTGTCTATAAATATGG + Intergenic
1109873520 13:68367137-68367159 AAAAGTCTTATCTTCAAATACGG + Intergenic
1109922139 13:69078704-69078726 AAATCTCTTGTCTACTGATAAGG - Intergenic
1109945394 13:69424798-69424820 AAAAATCATGTCTATTATTAAGG + Intergenic
1110064346 13:71084548-71084570 AATAGTCATTTCTGGTAATAAGG - Intergenic
1111014849 13:82366498-82366520 AGACATCATTTCTACTAATAAGG - Intergenic
1112513916 13:100035007-100035029 AAACGCCATCTCTACTAAAAAGG + Intergenic
1112766639 13:102752758-102752780 AAAGGCCACGTCTACAAATATGG - Intronic
1113327649 13:109297841-109297863 AAAAGTCACATCCACTAATAAGG - Intergenic
1113720120 13:112549653-112549675 AAAAGTTCTTACTACTAATAGGG - Intronic
1114734213 14:25026653-25026675 AAAAGTTATGTATGCAAATAAGG - Intronic
1115163456 14:30421454-30421476 GAAAGTCATGCTTCCTAATATGG + Intergenic
1115574784 14:34700520-34700542 AAAAGTGATATTTACTAATTTGG - Intergenic
1117281297 14:54243513-54243535 AAAAGGCATGTCTCATAATATGG + Intergenic
1117484027 14:56175749-56175771 AAAAGTCATATCTAATATAAAGG - Intronic
1117901622 14:60539537-60539559 AGAACTCATGTATACAAATAGGG - Intergenic
1118184455 14:63524069-63524091 AAAAATACTGTCTTCTAATAAGG - Intronic
1118875379 14:69780067-69780089 CAAAATGATGTCTAATAATAAGG + Intronic
1119332017 14:73801868-73801890 AATAATAATATCTACTAATACGG + Intergenic
1124191629 15:27582654-27582676 AAAAAGCAGGCCTACTAATATGG + Intergenic
1124807583 15:32901306-32901328 AAAAATCATTTCTCCAAATAAGG + Intronic
1125339056 15:38656731-38656753 AAAGGCCCTGTCTTCTAATACGG - Intergenic
1127448568 15:59092491-59092513 TAATGTCATCTCTACTAATAAGG + Intronic
1127460168 15:59191373-59191395 AAATGTCATGTCAATTAAAAAGG + Intronic
1127935970 15:63638496-63638518 AAATGTGATGTCTACTTATGGGG - Exonic
1129440375 15:75577565-75577587 AAATGTCATCTCCACAAATAAGG + Intronic
1130845672 15:87742784-87742806 AAAAATCACATCTAATAATATGG + Intergenic
1133359402 16:5162123-5162145 AAAAAGCAGGACTACTAATAAGG - Intergenic
1138970523 16:62137305-62137327 AAAACTCATTTCTACTAAGCTGG - Intergenic
1139120954 16:64016105-64016127 TAAAGTGATGTCTTCTAAAATGG + Intergenic
1150852918 17:68722422-68722444 ACAAGTCTTGTCTTCTAAAAAGG - Intergenic
1150858743 17:68778843-68778865 AAAAGTCATGTCTTTTAGGAGGG - Intergenic
1151099068 17:71534878-71534900 AAGAGTGATGTCTCCAAATAGGG + Intergenic
1152670653 17:81603245-81603267 CAAAGTCATGTTTACAAACAAGG - Intronic
1154104434 18:11508398-11508420 AAAAGTCATGAGAACAAATAGGG + Intergenic
1158186882 18:54780661-54780683 AAAGGTCCTGTCTCCAAATATGG + Intronic
1159747246 18:72253452-72253474 AACAGTATTGTCTACTATTATGG - Intergenic
1167691539 19:50987174-50987196 AACAATAATGTCTACTATTATGG - Intergenic
1167823965 19:51954910-51954932 AAAACTGATGTCTACCAAAAGGG + Intergenic
1202704071 1_KI270713v1_random:7900-7922 AATAGTGATATCTACTAATAAGG + Intergenic
925562478 2:5211794-5211816 AAAAGTAAAGTCTACGAATGGGG + Intergenic
925826722 2:7856690-7856712 AAAATTAATGTCTACTTATGTGG + Intergenic
927366084 2:22298195-22298217 AATAGTAATGTCCACTAATGGGG + Intergenic
930215781 2:48695585-48695607 AAAAGACATGTGCACTTATATGG + Intronic
931672517 2:64660681-64660703 AAAAGTCCTCTTTACTTATAAGG - Intronic
933243171 2:79945572-79945594 AATGGTCATGTCTATTAAAAAGG - Intronic
933611393 2:84439669-84439691 ATAAACCATGGCTACTAATAAGG - Intronic
939814165 2:146873426-146873448 AAAAGTCATTTCAATTAAAATGG + Intergenic
941187273 2:162332572-162332594 ATAACTCATGCCTACTAACAAGG + Intronic
942656455 2:178218938-178218960 AAAATTCAGGTCTAATAAAAAGG - Intronic
942693652 2:178614281-178614303 ATGAGTCATGTCTTCTAACATGG - Exonic
943655009 2:190499317-190499339 AAAAGTGATGGGTACTAATTTGG + Intronic
944265384 2:197719092-197719114 CATAGTTATGTCTACAAATATGG + Intronic
945243714 2:207699268-207699290 AAAAATCCTGTCTCCAAATATGG + Intergenic
945850855 2:215005004-215005026 AGAAGTTATGTCTTCTAATTTGG - Intronic
946957485 2:224947371-224947393 AAAAGTCAACTGTAATAATATGG + Intronic
948409956 2:237751668-237751690 ATATCTGATGTCTACTAATAAGG + Intronic
1169698896 20:8424475-8424497 AAAATTCATTTCTACTAAAAAGG - Intronic
1171002589 20:21429819-21429841 ATAAGTCATGTTTATGAATATGG + Intergenic
1173073186 20:39789767-39789789 AAGATTCATGTGTACTAATAGGG - Intergenic
1177302854 21:19272329-19272351 AAGAGTCATGGATACTACTATGG - Intergenic
1179347365 21:40571763-40571785 AAACCTCATCTCTACTAAAATGG - Intronic
1182973961 22:34605023-34605045 TAAAGTCGTGTCTACAACTAGGG + Intergenic
951119666 3:18910613-18910635 AATAGTGATATCTGCTAATAAGG - Intergenic
951971486 3:28449817-28449839 AAAAATCATTTGTACTAATGGGG - Intronic
952250060 3:31644542-31644564 AATAGGGATGTCTAATAATAGGG - Intergenic
954321770 3:49836934-49836956 AAAAGTCATGTCAAGGAAGATGG - Intronic
955603988 3:60679528-60679550 AAAAATTATATCTAATAATATGG - Intronic
955982032 3:64536545-64536567 AAAAGACATGTCTACTATCATGG + Intronic
956460169 3:69463735-69463757 TAGAGTCATGGTTACTAATAGGG - Intronic
956857589 3:73291206-73291228 TAATTTAATGTCTACTAATATGG - Intergenic
957987317 3:87589113-87589135 AAATGTCATATCTACTAAAAAGG - Intergenic
959659869 3:108855273-108855295 AAAAGTCCTGTCTAGGATTATGG - Intergenic
961423040 3:126821903-126821925 AAAAGACATATAAACTAATATGG - Intronic
964290589 3:155175764-155175786 TATAGACATGTCAACTAATATGG + Intronic
965338968 3:167462570-167462592 AAAAATCTTGTCTCCAAATAAGG + Intronic
967621047 3:191633963-191633985 GAAAGTAATATCTACTAAGAAGG + Intergenic
967671726 3:192244477-192244499 AATAGACATATCTACTTATATGG + Intronic
968387140 4:151653-151675 AAACCTCATCTCTACTAAAAAGG - Intronic
968783521 4:2601190-2601212 AAAAGTCAAATCTACAAATCAGG - Intronic
969360618 4:6661015-6661037 AAAACCCATCTCTACTAAAAAGG - Intergenic
974268661 4:59620489-59620511 AAAAGTCATGTGGATTAAAAAGG + Intergenic
974441386 4:61922931-61922953 AAAGGTCATATTTACTCATATGG - Intronic
977026941 4:91831686-91831708 AAAAGCAATGTCTATTATTATGG - Intergenic
978630136 4:110734581-110734603 AAACGTTATGTCTTCTGATATGG + Intergenic
979562618 4:122117463-122117485 AAAATTCTTATGTACTAATATGG + Intergenic
980058330 4:128100648-128100670 AACAGACATTTCCACTAATAAGG - Intronic
981991864 4:150931307-150931329 AAAAGGCATGTATATGAATAAGG + Intronic
987666089 5:20942194-20942216 AGAAGAAATGTCTACTAATGGGG + Intergenic
988756598 5:34259977-34259999 AGAAGAAATGTCTACTAATGGGG - Intergenic
990097798 5:52139565-52139587 ACAAATCATCTGTACTAATAAGG - Intergenic
992847492 5:80766163-80766185 AAAAGACTTGTGTACCAATATGG - Intronic
994228252 5:97280679-97280701 AATAGTCATCTATACTATTAAGG - Intergenic
994404539 5:99328249-99328271 GAAAGTTATTTCTACTATTAAGG - Intergenic
994752572 5:103756689-103756711 AAAAGTCATTTCTCAAAATAAGG + Intergenic
994901892 5:105783662-105783684 AAGAATGATGTCTACTAATAAGG - Intergenic
995183521 5:109250057-109250079 AAACTTCATGCCTACTAATGTGG - Intergenic
998302454 5:141037338-141037360 AAAAATCATGCCTACAGATATGG - Intergenic
999032115 5:148305714-148305736 AAAAATCATGTTTACTAGGAAGG - Intergenic
1000782254 5:165496860-165496882 AAATGTTATGTCAAGTAATAAGG - Intergenic
1001150676 5:169225063-169225085 AAAAGTACTTCCTACTAATAAGG + Intronic
1002113064 5:176933875-176933897 AAAAGTCATGCCCAATATTAGGG + Intronic
1004443157 6:15672621-15672643 AAATGCCTTGTCTACTCATAAGG + Intergenic
1005162094 6:22875868-22875890 AAAAATAATGTCACCTAATATGG - Intergenic
1008628596 6:53342769-53342791 AAAAGTCCAATCTAATAATAAGG + Intronic
1010213494 6:73381802-73381824 GAAACCCATGTCTACTAAAAAGG + Intronic
1010759464 6:79706447-79706469 AACAGTGATGACTATTAATAGGG + Intergenic
1011156042 6:84333889-84333911 AACAGTCATTTCTGCTAAAATGG - Intergenic
1011347537 6:86388662-86388684 AAAAGTCATGAGTATTGATATGG + Intergenic
1012257281 6:97048584-97048606 AAAAGTCATGTGAACTTATTAGG - Intronic
1012387077 6:98694693-98694715 AAAAGTCATATTTGCTGATAGGG - Intergenic
1012941965 6:105424929-105424951 AAAAATATTATCTACTAATAAGG + Intergenic
1014498501 6:122157241-122157263 AAAAATCATGACTTCTAATTGGG + Intergenic
1014647800 6:123996242-123996264 AAATGTCAGGTCTATTAATGAGG + Intronic
1015350591 6:132213484-132213506 AAAAGTGATTTCTAATAGTAAGG + Intergenic
1016055974 6:139578273-139578295 GAAAGGCATGTCTACTTAGAGGG - Intergenic
1020479390 7:8639135-8639157 AAAAATCATATAAACTAATAAGG + Intronic
1023563460 7:41499871-41499893 CACAGTTATGACTACTAATATGG + Intergenic
1024685456 7:51739771-51739793 AAATGCCATGTCTACTCATTGGG + Intergenic
1024754273 7:52511082-52511104 AATAGTCAGGGCTACTAACAGGG + Intergenic
1028293640 7:89099628-89099650 AAAAGTCATGTCCACAATTTGGG + Intronic
1028447653 7:90943602-90943624 AAAATACAAGTCTATTAATAAGG - Intronic
1031388767 7:121187072-121187094 AAAAATCATGTCTACTTTGATGG - Intronic
1031508888 7:122624279-122624301 ACAAGTCATGTGTTCTAATTAGG + Intronic
1033875103 7:145806244-145806266 AAAACTCATGTTTTTTAATATGG + Intergenic
1035251981 7:157603711-157603733 AAAAGCCATGTCTTCTAGTCAGG + Intronic
1035413196 7:158662659-158662681 AAAAGGCATGTTTTTTAATAGGG - Intronic
1035932078 8:3791491-3791513 AAAAGTCATCTCTACAACAAGGG + Intronic
1037304820 8:17494209-17494231 AAATCTCATGTCCACAAATAAGG - Intergenic
1037594065 8:20339740-20339762 GAAACTCATGTCCACTGATATGG + Intergenic
1038630120 8:29234024-29234046 CAAAGTCATGTCAACAATTAGGG + Intronic
1040525048 8:48214949-48214971 AAAATTCATGTGTAATATTAAGG + Intergenic
1041203327 8:55472733-55472755 CAAAGTCATTTCTATTATTAGGG + Intronic
1041458827 8:58089510-58089532 TAAAATGATGTCTGCTAATAGGG - Intronic
1041512580 8:58668077-58668099 GGAAGTCATGTGAACTAATAGGG - Intergenic
1041806681 8:61858006-61858028 AAAAATCATGACAAATAATATGG + Intergenic
1043636857 8:82395417-82395439 AAAAATCATTTATACTTATAAGG + Intergenic
1044120932 8:88394314-88394336 AAAAGTCATGTATTCTAAAGAGG + Intergenic
1045114555 8:98968939-98968961 AAAGGTCATGTCTACCTCTAAGG - Intergenic
1047917480 8:129597740-129597762 AAAAGACATTTCTCCAAATAAGG - Intergenic
1050377509 9:4987864-4987886 AAAAGTCTTGGCTACTATCACGG + Intronic
1051156844 9:14157667-14157689 AAAAGTCATGAATACAAAAAAGG + Intronic
1055172614 9:73277854-73277876 AAAAATCATACTTACTAATATGG + Intergenic
1055782247 9:79832496-79832518 AAAAGTCATTTGTACAAATGGGG + Intergenic
1057326814 9:94072462-94072484 AACAATCATGTCTGCAAATAAGG + Intronic
1058223783 9:102335582-102335604 AAAAGTAATGTCAAATAACATGG - Intergenic
1185785007 X:2883424-2883446 ACACGTCATGTCTACTGATCAGG + Intergenic
1186950372 X:14617851-14617873 AAAAGTTATGGCTGCTAAGAAGG + Intronic
1188499472 X:30809755-30809777 AAAACTCATGTCTCCAAATGAGG - Intergenic
1190002303 X:46700815-46700837 AAAAGAAATGTTTACTAATTGGG - Intronic
1190570858 X:51779875-51779897 CAAAGTCAACTCCACTAATATGG + Intergenic
1190896698 X:54625744-54625766 AAAAGTCATAGTTAATAATATGG + Intergenic
1191731378 X:64339319-64339341 AAAAGTCAGGACTACAAAAAGGG + Intronic
1192932532 X:75823046-75823068 TAAAATCATCACTACTAATATGG + Intergenic
1193737255 X:85173622-85173644 AAAAGTTATATCTCCTAATTTGG - Intergenic
1194582455 X:95692920-95692942 AAAAGTCAGGTCATCTTATATGG - Intergenic
1197331956 X:125163644-125163666 AATAGTCATGTTTTCCAATATGG + Intergenic
1197771553 X:130092564-130092586 TAAAGTCATTTCTACTCATCTGG - Intronic
1198213927 X:134539247-134539269 GAAAGTAATGTCTAGTCATATGG + Intergenic
1198913926 X:141645200-141645222 TAAAGTCATATATACTAACATGG - Intronic
1201924219 Y:19267243-19267265 AAAAGAAATGCCTTCTAATATGG - Intergenic