ID: 1064629127

View in Genome Browser
Species Human (GRCh38)
Location 10:17291503-17291525
Sequence TATCCAAAGCTGCTAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064629127_1064629129 26 Left 1064629127 10:17291503-17291525 CCTCTTTTTAGCAGCTTTGGATA No data
Right 1064629129 10:17291552-17291574 CTTTCTTATTTTTAAGATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064629127 Original CRISPR TATCCAAAGCTGCTAAAAAG AGG (reversed) Intergenic
No off target data available for this crispr