ID: 1064632325

View in Genome Browser
Species Human (GRCh38)
Location 10:17329035-17329057
Sequence TGGGGCATCTTCTGTCACTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064632325_1064632329 12 Left 1064632325 10:17329035-17329057 CCGGAGTGACAGAAGATGCCCCA No data
Right 1064632329 10:17329070-17329092 CTGCTGTCTGCCCCTAATGCTGG No data
1064632325_1064632330 18 Left 1064632325 10:17329035-17329057 CCGGAGTGACAGAAGATGCCCCA No data
Right 1064632330 10:17329076-17329098 TCTGCCCCTAATGCTGGCTCTGG No data
1064632325_1064632331 19 Left 1064632325 10:17329035-17329057 CCGGAGTGACAGAAGATGCCCCA No data
Right 1064632331 10:17329077-17329099 CTGCCCCTAATGCTGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064632325 Original CRISPR TGGGGCATCTTCTGTCACTC CGG (reversed) Intronic