ID: 1064632328

View in Genome Browser
Species Human (GRCh38)
Location 10:17329055-17329077
Sequence GACAGCAGTCACAATGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064632328_1064632335 26 Left 1064632328 10:17329055-17329077 CCAGAATCATTGTGACTGCTGTC No data
Right 1064632335 10:17329104-17329126 GCCCAACTAGCAAAGAAACTCGG No data
1064632328_1064632331 -1 Left 1064632328 10:17329055-17329077 CCAGAATCATTGTGACTGCTGTC No data
Right 1064632331 10:17329077-17329099 CTGCCCCTAATGCTGGCTCTGGG No data
1064632328_1064632329 -8 Left 1064632328 10:17329055-17329077 CCAGAATCATTGTGACTGCTGTC No data
Right 1064632329 10:17329070-17329092 CTGCTGTCTGCCCCTAATGCTGG No data
1064632328_1064632330 -2 Left 1064632328 10:17329055-17329077 CCAGAATCATTGTGACTGCTGTC No data
Right 1064632330 10:17329076-17329098 TCTGCCCCTAATGCTGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064632328 Original CRISPR GACAGCAGTCACAATGATTC TGG (reversed) Intronic