ID: 1064632331

View in Genome Browser
Species Human (GRCh38)
Location 10:17329077-17329099
Sequence CTGCCCCTAATGCTGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064632326_1064632331 1 Left 1064632326 10:17329053-17329075 CCCCAGAATCATTGTGACTGCTG No data
Right 1064632331 10:17329077-17329099 CTGCCCCTAATGCTGGCTCTGGG No data
1064632328_1064632331 -1 Left 1064632328 10:17329055-17329077 CCAGAATCATTGTGACTGCTGTC No data
Right 1064632331 10:17329077-17329099 CTGCCCCTAATGCTGGCTCTGGG No data
1064632327_1064632331 0 Left 1064632327 10:17329054-17329076 CCCAGAATCATTGTGACTGCTGT No data
Right 1064632331 10:17329077-17329099 CTGCCCCTAATGCTGGCTCTGGG No data
1064632325_1064632331 19 Left 1064632325 10:17329035-17329057 CCGGAGTGACAGAAGATGCCCCA No data
Right 1064632331 10:17329077-17329099 CTGCCCCTAATGCTGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064632331 Original CRISPR CTGCCCCTAATGCTGGCTCT GGG Intronic