ID: 1064632333

View in Genome Browser
Species Human (GRCh38)
Location 10:17329081-17329103
Sequence AGCTCCCAGAGCCAGCATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064632333_1064632338 24 Left 1064632333 10:17329081-17329103 CCCTAATGCTGGCTCTGGGAGCT No data
Right 1064632338 10:17329128-17329150 TTCAGTACAACTCTCTTTGTAGG No data
1064632333_1064632335 0 Left 1064632333 10:17329081-17329103 CCCTAATGCTGGCTCTGGGAGCT No data
Right 1064632335 10:17329104-17329126 GCCCAACTAGCAAAGAAACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064632333 Original CRISPR AGCTCCCAGAGCCAGCATTA GGG (reversed) Intronic