ID: 1064632335

View in Genome Browser
Species Human (GRCh38)
Location 10:17329104-17329126
Sequence GCCCAACTAGCAAAGAAACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064632328_1064632335 26 Left 1064632328 10:17329055-17329077 CCAGAATCATTGTGACTGCTGTC No data
Right 1064632335 10:17329104-17329126 GCCCAACTAGCAAAGAAACTCGG No data
1064632334_1064632335 -1 Left 1064632334 10:17329082-17329104 CCTAATGCTGGCTCTGGGAGCTG No data
Right 1064632335 10:17329104-17329126 GCCCAACTAGCAAAGAAACTCGG No data
1064632327_1064632335 27 Left 1064632327 10:17329054-17329076 CCCAGAATCATTGTGACTGCTGT No data
Right 1064632335 10:17329104-17329126 GCCCAACTAGCAAAGAAACTCGG No data
1064632333_1064632335 0 Left 1064632333 10:17329081-17329103 CCCTAATGCTGGCTCTGGGAGCT No data
Right 1064632335 10:17329104-17329126 GCCCAACTAGCAAAGAAACTCGG No data
1064632332_1064632335 1 Left 1064632332 10:17329080-17329102 CCCCTAATGCTGGCTCTGGGAGC No data
Right 1064632335 10:17329104-17329126 GCCCAACTAGCAAAGAAACTCGG No data
1064632326_1064632335 28 Left 1064632326 10:17329053-17329075 CCCCAGAATCATTGTGACTGCTG No data
Right 1064632335 10:17329104-17329126 GCCCAACTAGCAAAGAAACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064632335 Original CRISPR GCCCAACTAGCAAAGAAACT CGG Intronic