ID: 1064632338

View in Genome Browser
Species Human (GRCh38)
Location 10:17329128-17329150
Sequence TTCAGTACAACTCTCTTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064632333_1064632338 24 Left 1064632333 10:17329081-17329103 CCCTAATGCTGGCTCTGGGAGCT No data
Right 1064632338 10:17329128-17329150 TTCAGTACAACTCTCTTTGTAGG No data
1064632334_1064632338 23 Left 1064632334 10:17329082-17329104 CCTAATGCTGGCTCTGGGAGCTG No data
Right 1064632338 10:17329128-17329150 TTCAGTACAACTCTCTTTGTAGG No data
1064632337_1064632338 -1 Left 1064632337 10:17329106-17329128 CCAACTAGCAAAGAAACTCGGTT No data
Right 1064632338 10:17329128-17329150 TTCAGTACAACTCTCTTTGTAGG No data
1064632332_1064632338 25 Left 1064632332 10:17329080-17329102 CCCCTAATGCTGGCTCTGGGAGC No data
Right 1064632338 10:17329128-17329150 TTCAGTACAACTCTCTTTGTAGG No data
1064632336_1064632338 0 Left 1064632336 10:17329105-17329127 CCCAACTAGCAAAGAAACTCGGT No data
Right 1064632338 10:17329128-17329150 TTCAGTACAACTCTCTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064632338 Original CRISPR TTCAGTACAACTCTCTTTGT AGG Intronic