ID: 1064638170 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:17389542-17389564 |
| Sequence | TCTTCCATGTAGATGAGGCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1064638164_1064638170 | 15 | Left | 1064638164 | 10:17389504-17389526 | CCTTCTAGGAACAATCAGAGTCT | 0: 1 1: 0 2: 0 3: 12 4: 109 |
||
| Right | 1064638170 | 10:17389542-17389564 | TCTTCCATGTAGATGAGGCATGG | No data | ||||
| 1064638162_1064638170 | 30 | Left | 1064638162 | 10:17389489-17389511 | CCATTGGACTGGGCACCTTCTAG | 0: 1 1: 0 2: 1 3: 6 4: 105 |
||
| Right | 1064638170 | 10:17389542-17389564 | TCTTCCATGTAGATGAGGCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1064638170 | Original CRISPR | TCTTCCATGTAGATGAGGCA TGG | Intronic | ||
| No off target data available for this crispr | |||||