ID: 1064638170

View in Genome Browser
Species Human (GRCh38)
Location 10:17389542-17389564
Sequence TCTTCCATGTAGATGAGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064638164_1064638170 15 Left 1064638164 10:17389504-17389526 CCTTCTAGGAACAATCAGAGTCT 0: 1
1: 0
2: 0
3: 12
4: 109
Right 1064638170 10:17389542-17389564 TCTTCCATGTAGATGAGGCATGG No data
1064638162_1064638170 30 Left 1064638162 10:17389489-17389511 CCATTGGACTGGGCACCTTCTAG 0: 1
1: 0
2: 1
3: 6
4: 105
Right 1064638170 10:17389542-17389564 TCTTCCATGTAGATGAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064638170 Original CRISPR TCTTCCATGTAGATGAGGCA TGG Intronic
No off target data available for this crispr